METHODS AND COMPOSITIONS FOR GENETIC TRANSFER THROUGH VASCULATURE

专利摘要:
the present invention relates to aav capsid proteins comprising a modification in the amino acid and capsid sequence of viruses and virus vectors comprising the modified aav capsid protein. the present invention also relates to methods of administering the virus vectors and virus capsids of the disclosure to a cell or subject in vivo.
公开号:BR112019016769A2
申请号:R112019016769-2
申请日:2018-02-15
公开日:2020-05-26
发明作者:Asokan Aravind；MURLIDHARAN Giridhar；ALBRIGHT Blake
申请人:The University Of North Carolina At Chapel Hill；
IPC主号:

专利说明:

Invention Patent Descriptive Report for "METHODS AND COMPOSITIONS FOR GENETIC TRANSFER THROUGH VASCULATURE".
CROSS REFERENCE
[0001] This application claims the benefit, under 35 USC § 119 (e), of United States Provisional Patent Application US No. 62 / 459,286 filed on February 15, 2017, which is incorporated by reference here, to this patent application, in its entirety for all purposes.
GOVERNMENT SUPPORT STATEMENT
[0002] This invention was produced with government support according to Grants (N.T .: Concessões) Nos. P01HL112761 and R01HL089221 granted by the National Institutes of Health. The government has certain rights in the present invention.
SEQUENCE LISTING
[0003] The Sequence Listing associated with this application is provided in text format instead of a hard copy, and is hereby incorporated by reference in the specification. The name of the text file containing the String Listing is STRD_004_01WO_SeqListSST25.txt. The text file is 4 KB, and was created on February 14, 2018, and is being submitted electronically via EFS-Web.
FIELD OF THE INVENTION
[0004] The present invention relates to modified adeno-associated virus (AAV) capsid proteins and virus capsids and virus vectors comprising them. In particular, the invention relates to modified AAV capsid proteins and capsids comprising the same that can be incorporated into virus vectors to provide a desirable transduction profile with respect to one or more target tissues of interest.
Petition 870190078272, of 8/13/2019, p. 176/335
2/120
BACKGROUND OF THE INVENTION
[0005] New strains of the adeno-associated virus (AAV) isolated from animal tissues and adenoviral stocks have expanded the range of AAV vectors available for therapeutic gene transfer applications. Extensive efforts are currently underway to map the tissue tropisms of these AAV isolates in animal models. The ability for direct homing of AAV vectors to selective organs is useful for gene therapy and other therapeutic applications.
[0006] The present invention addresses a need in the technique of nucleic acid release vectors with desirable targeting characteristics.
SUMMARY OF THE INVENTION
[0007] In some embodiments, the present disclosure provides an adeno-associated virus (AAV) capsid protein, wherein the AAV capsid protein comprises a modification in amino acid residues S262, A263, S264, T265, A267, S268 and H272, and a single amino acid residue insert between residues G266 and A267, (VP1 numbering), where the numbering of each residue is based on the amino acid sequence of AAV1 (SEQ ID NO: 1) or the amino acid residue equivalent in AAV2 (SEQ ID NO:
2), AAV3 (SEQ ID NO: 3), AAV6 (SEQ ID NO: 4), AAV7 (SEQ ID NO:
5), AAV8 (SEQ ID NO: 6), AAV9 (SEQ ID NO: 7) or AAVrhIO (SEQ ID NO: 8). In some embodiments, the AAV capsid protein of this invention may further comprise a modification in amino acid residues Q148, E152, S157, T162, T326, D328, V330, T331, V341 and S345, and a single insertion of amino acid residue between residues E152 and P153 (numbering VP1) where the numbering of each residue is based on the amino acid sequence of SEQ ID NO: 1 or the equivalent amino acid residue in SEQ ID
Petition 870190078272, of 8/13/2019, p. 177/335
3/120
NOs: 2, 3, 4, 5, 6, 7 or 8. In additional embodiments, the AAV capsid protein of this invention may additionally comprise a modification of amino acid residues L188, S205, N223 and A224 (numbering VP1), in that the numbering of each residue is based on the amino acid sequence of SEQ ID NO: 1 or the equivalent amino acid residue in SEQ ID NOs: 2, 3, 4, 5, 6, 7 or 8.
[0008] In some embodiments, the present disclosure provides an adeno-associated virus (AAV) capsid protein, wherein the AAV capsid protein comprises a modification in amino acid residues S262, A263, S264, T265, and A267 ( numbering VP1), and a single amino acid residue insert between residues S268 and N269, where the amino acid residues are based on the amino acid sequence of AAV1 (SEQ ID NO: 1) or the equivalent amino acid residues in AAV2 (SEQ ID NO: 2), AAV3 (SEQ ID NO: 3), AAV6 (SEQ ID NO: 4), AAV7 (SEQ ID NO: 5), AAV8 (SEQ ID NO: 6), AAV9 (SEQ ID NO: 7) or AAVrhW (SEQ ID NO: 8). In some embodiments, the capsid protein additionally comprises a modification in the amino acid residue H272. In some embodiments, the AAV capsid protein additionally comprises a modification of amino acid residues Q148, E152, S157, T162, H272, T326, D328, V330, T331, V341 and S345, and a single amino acid residue insert between the waste E152 and P153. In additional embodiments, the AAV capsid protein additionally comprises a modification in amino acid residues L188, S205, N223, A224, and H272.
[0009] In some embodiments, the present invention provides an adeno-associated virus (AAV) capsid protein, wherein the AAV capsid protein comprises a modification resulting in the amino acid sequence: X ¹ -X ² -X ³ - X ⁴ (SEQ ID NO: 35) in the amino acids corresponding to amino acid positions 262 to 265
Petition 870190078272, of 8/13/2019, p. 178/335
4/120 (VP1 numbering) of the native AAV1 capsid protein (SEQ ID NO: 1), where X ¹ is any amino acid other than S; where X ² is any amino acid other than A; where X ³ is any amino acid other than S; and where X ⁴ is any amino acid other than T.
[00010] In some embodiments, the present invention provides an adeno-associated virus (AAV) capsid protein, wherein the AAV capsid protein comprises a modification in amino acid residues S262, A263, S264, T265, A267, and H272, and a single insertion of amino acid residue between residues S268 and N269, (VP1 numbering), where the numbering of each residue is based on the amino acid sequence of AAV1 (SEQ ID NO: 2) or the equivalent amino acid residue in AAV1 (SEQ ID NO: 1), AAV3 (SEQ ID NO: 3), AAV6 (SEQ ID NO: 4), AAV7 (SEQ ID NO: 5), AAV8 (SEQ ID NO: 6), AAV9 (SEQ ID NO: 7) or AAVrhW (SEQ ID NO: 8).
[00011] In some embodiments, the present invention provides an adeno-associated virus (AAV) capsid protein, wherein the AAV capsid protein comprises a modification in amino acid residues S262, Q263, S264, A266, S267, and H271, and an insertion of at least one amino acid residue between residues S261 and S262, (VP1 numbering), where the numbering of each residue is based on the amino acid sequence of AAV2 (SEQ ID NO: 2) or the residue of equivalent amino acid in AAV1 (SEQ ID NO: 1), AAV3 (SEQ ID NO: 3), AAV6 (SEQ ID NO: 4), AAV7 (SEQ ID NO:
5), AAV8 (SEQ ID NO: 6), AAV9 (SEQ ID NO: 7) or AAVrhW (SEQ ID NO: 8).
[00012] In some embodiments, the present invention provides an adeno-associated virus (AAV) capsid protein, wherein the AAV capsid protein comprises a modification in amino acid residues S262, Q263, S264, A266, A267, H271 , and a single insertion of amino acid residue between residues S261 and
Petition 870190078272, of 8/13/2019, p. 179/335
5/120
S262, where the numbering of each residue is based on the amino acid sequence of AAV3 (SEQ ID NO: 3) or the equivalent amino acid residue in AAV1 (SEQ ID NO: 1), AAV2 (SEQ ID NO: 2), AAV6 (SEQ ID NO: 4), AAV7 (SEQ ID NO: 5), AAV8 (SEQ ID NO: 6), AAV9 (SEQ ID NO: 7) or AAVrhW (SEQ ID NO: 8).
[00013] In some embodiments, the present invention provides an adeno-associated virus (AAV) capsid protein, wherein the AAV capsid protein comprises a modification in amino acid residues S263, S269, A237 (numbering VP1), in that the numbering of each residue is based on the amino acid sequence of AAV9 (SEQ ID NO: 9) or the equivalent amino acid residue in AAV1 (SEQ ID NO: 1), AAV2 (SEQ ID NO: 2), AAV3 (SEQ ID NO: 3), AAV6 (SEQ ID NO: 4), AAV7 (SEQ ID NO: 5), AAV8 (SEQ ID NO: 6), or AAVrhIO (SEQ ID NO: 8).
[00014] In some embodiments, the present invention provides an adeno-associated virus (AAV) capsid protein, wherein the AAV capsid protein comprises the sequence of any one of SEQ ID NO: 9 to SEQ ID NO: 34 .
[00015] The present disclosure further provides an AVV capsid comprising a capsid protein of the disclosure, as well as a virus vector comprising an AVV capsid of the disclosure. In some embodiments, the virus vector comprises an AVV capsid of the disclosure and a nucleic acid comprising at least one terminal repeat sequence, in which the nucleic acid is encapsulated by the AVV capsid.
[00016] The present disclosure further provides pharmaceutical compositions comprising the AVV capsids and / or virus vectors disclosed herein, in this patent application.
[00017] Also provided here, in this patent application, is a method of introducing a nucleic acid molecule into
Petition 870190078272, of 8/13/2019, p. 180/335
6/120 of a cell, comprising contacting the cell with a vector of the disclosure virus, as well as a method of releasing a nucleic acid molecule to a subject, comprising administering to the subject a vector of the disclosure virus.
[00018] Furthermore, the present disclosure provides a method of selectively releasing a nucleic acid molecule of interest to a neuronal cell, comprising contacting the neuronal cell with the virus vector of this invention, wherein the virus vector comprises the molecule of nucleic acid of interest.
[00019] In yet another embodiment, the present disclosure provides a method of treating a neurological defect or disorder in a subject, comprising administering to the subject a virus vector of the disclosure, wherein the virus vector comprises a nucleic acid molecule that encodes a therapeutic protein or therapeutic RNA effective in treating neurological defect or disorder.
[00020] These and other aspects are covered in more detail in the description stipulated below.
BRIEF DESCRIPTION OF THE DRAWINGS
[00021] FIG. 1. Quantification of cortical neuron transduction. Female BL6 mice from 6 to 8 weeks of age were administered systemically through injections into the tail vein with a dose of 5 χ 10 ¹¹ vg (vector genomes) of vectors that package CBh-scGFP (AAV1, AAV1R6 or AAV1R7) or with PBS as a negative control. The mice were sacrificed 21 days after the injection and the tissues were collected, fixed, and sectioned. The tissues were immunostained for GFP using a DAB substrate, the GFP expression was visualized using slide scanning and the ImageScope software. Neurons positive for GFP in the cerebral cortex were manually counted, quantified and calculated through multiple coronal brain sections per mouse. N = 2 for AAV1; n = 3
Petition 870190078272, of 8/13/2019, p. 181/335
7/120 for AAV1R6 and AAV1R7.
[00022] FIG. 2. Crossing of cerebral vasculature and neuronal expression. AAV vectors that package a CbhscGFP transgene were administered to C57 / BI6 mice by injection into the tail vein at a dose of 5 χ 10 ¹¹ vg. The mice were sacrificed 21 days after the injection, the tissues were collected, fixed, sectioned, stained with DAB to detect GFP, visualized through images obtained via Aperio Scanner and image processing performed with the ImageScope software. Abbreviations: Cortex (CTX), motor cortex (MOT), striated (STR), hippocampus (HO), dentate gyrus (DG). N = 3.
[00023] FIG. 3. Detargeting of the liver. The AAV vectors that package a CBA-luciferase transgene were administered to C57 / BI6 mice by injection into the tail vein at a dose of 1 χ 10 ¹¹ vg. The mice were sacrificed 14 days after the injection, the tissues were collected, chopped, lysed and luciferase assays were performed to detect the levels of relative transduction to the brain, heart, liver, and spinal cord tissues. The data were normalized as relative light units per gram of tissue. N = 3.
[00024] FIGS. 4A to C. Phylogenetic and structural analysis of the AAV1 / rh.10 domain exchange capsid library. FIG. 4A. Schematic diagram of the panel of representative chimeric AAV1 / rh.10 capsids isolated from the library showing diversity of sequences, at the level of amino acids, of domain exchanges obtained through shuffling. Parental or chimeric individual capsids are listed vertically, while the VP1 capsid sequence with interchanges from different domains is presented horizontally, from the N-terminal on the left to the C-terminal on the right. Residues derived from AAV1 are shown in gray, the residues
Petition 870190078272, of 8/13/2019, p. 182/335
8/120 AAVrh.10 residues in cyan green and the consensus residues between the two in black. FIG. 4B. Phylogeny of joining neighbors of the VP1 capsid sequences of chimeric capsids AAV1 / rh.1O. Amino acid sequences of capsids were aligned with ClustalW and the phylogeny was generated using a neighbor joining algorithm. A Poisson correction was used to calculate distances of amino acids, represented as units of the number of amino acid substitutions per location. The tree is drawn to scale, with branch lengths in the same units as the evolutionary distances used to infer the tree. Bootstrap values were calculated with 1000 replicates and the percentage of replicate trees in which the associated rates grouped together are shown next to the branches. FIG. 4C. Three-dimensional models of the surface of the capsid subunit trimer / axis of triple symmetry regions of parental and representative chimeric chimeric AVV mutants selected for in vivo screening. Amino acid residues derived from AAV1 are shown in gray, while residues derived from AAVrh.10 are shown in cyan green. Structural models were visualized and generated using PyMol.
[00025] FIG. 5. In vivo screening produces AAV1 / rh.10 chimeras capable of crossing the blood-brain barrier after intravenous administration. Scans of immunostained brain sections showing GFP expression in the cerebral cortex mediated by parental or chimeric vectors that package a CBh-scGFP transgene in three weeks after administration by injection into the tail vein at a dose of 5 x 10 ¹¹ vg (or PBS in the case of simulated treatment). The global coronal brain section (top) indicates the boxed region of the cortex seen in the insects shown for each parental or chimeric vector, representing their profiles
Petition 870190078272, of 8/13/2019, p. 183/335
9/120 individual transduction. Scale bar = 100 pm.
[00026] FIGS. 6A to G. In vivo screening of AAV1 / rh.1O chimeras for their ability to cross the blood-brain barrier and transduce several brain regions after intravascular administration. The mice received a 5 x 10 ¹¹ vg dose of either a parental (AAV1 or AAVrh.10) or chimeric vector that packages a CBh-scGFP transgene by injection into the tail vein. Brain sections immunostained and studied by images show GFP expression, such as black / dark brown color, in 21 days after the injection. Scale bar = 100 pm. The global coronal brain section at the top of the figure indicates the various brain regions shown in the insects: MCT, motor cortex (FIG. 6A); HC, hippocampus (FIG. 6B); DG, toothed rotation (FIG. 6C); TH, thalamus (FIG 6D); HY, hypothalamus (FIG. 6E); STR, striatum (FIG. 6F); Amg, amygdala (FIG. 6G). n = 3 for each.
[00027] FIGS. 7A to H. Transduction profile in the central nervous system of AAV1R6 and AAV1R7 compared to parental AAV1 and AAVrh.10 in the brain. Transduction profiles are shown three weeks after injection into the tail vein of AAV vectors that package a CBh-scGFP transgene in a dose of 5 x 10 ¹¹ vg for the parental serotypes, AAV1 and AAVrh.10 (columns on the left) , and for AAV1R6 and AAV1R7 (columns on the right) through various brain regions, including the motor cortex (FIG. 7A), the cerebral cortex (somatosensory) (FIG. 7B), the hippocampus (FIG. 7C), the dentate gyrus (FIG. 7D), the thalamus (FIG. 7E), the hypothalamus (FIG. 7F), the striatum (FIG. 7G), and the amygdala (FIG. 7H). Scale bar = 100 pm.
[00028] FIGS. 8A to H. Quantitative comparison of neuronal and glial transduction levels for parental and chimeric capsid variants. Levels of relative neuronal transduction at 3 weeks after administration of vectors that package a CBh transgene
Petition 870190078272, of 8/13/2019, p. 184/335
10/120 scGFP by injection into the tail vein at a dose of 5x 10 ¹¹ vg were quantified by counting the number of transduced neurons and glia, identified based on morphology, for each brain region, by 50 pm coronal section. The transduction of the parental serotypes, AAV1 and AAVrh.10, is shown, alongside the chimeric variants, AAV1R6 and AAV1R7, through various regions of the brain, including the motor cortex (FIG. 8A), the cerebral cortex (somatosensory) (FIG. 8B), the hippocampus (FIG. 8C), the toothed gyrus (FIG. 8D), the thalamus (FIG. 8E), the hypothalamus (FIG. 8F), the striatum (FIG. 8G), and the amygdala (FIG 8H). Error bars represent standard deviation (n> or = 3). A two-tailed unpaired test with Welch correction and one-way ANOVA were used to demonstrate the statistical significance for neuronal and glial transduction by each group in relation to AAV1, and the differences between the means were statistically significant, respectively. ns, not significant; *, P <0.05.
[00029] FIGS. 9A to F. Structural analysis of the chimeric capsid variant AAV1R6. (FIG. 9A) The alignment of AAV1R6 sequences with AAV1 and AAVrh.10 highlights the amino acid residues (numbering AAV1R6) that are solely derived from AAVrh.10 (shown in black letters and highlighted in blue). Conserved residues are in red letters and highlighted in yellow, while equivalent residues not preserved in AAV1 are shown in black or green text and are highlighted in either green or white. The three-dimensional structural model of the chimeric subunit monomer AAV1R6 VP3 (FIG. 9B) was generated using SWISS-MODEL with the crystalline structure of AAV8 serving as the model for homology modeling (PDB ID: 2QAO). Superficial models of the AAV1R6 VP3 subunit (FIG. 9C) dimer trimmer / double symmetry axis, (FIG. 9D) trimer / triple symmetry axis, (FIG. 9E) pentamer / quintuple symmetry axis (FIG.
Petition 870190078272, of 8/13/2019, p. 185/335
11/120
9F) superficial rendering of an intact AAV1R6 capsid (60mer) through the VIPERdb oligomer generator and were visualized using PyMol. Residues derived from AAV1 are colored gray while residues derived from AAVrh.10, clustered at the base of the protrusions on the triple symmetry axis, depression on the double symmetry axis and in the quintuple pore 5, are colored in cyan green.
[00030] FIGS. 10A to B. Relative cardiac and hepatic transduction by AAV1R6 and AAV1R7 compared to parental capsids. Or parental (AAV1 or AAVrh.10) or chimeric (AAV1R6 or AAV1R7) vectors that package a CBh-scGFP transgene were administered in a 5 x 10 vg dose via injection into the tail vein. At 21 days after the injection, cardiac and liver sections were immunostained for GFP and studied by images. FIG. 10A. GFP fluorescence for cardiac (upper panel) and liver (lower panel) tissues in mice treated with or PBS (Pseudo), AAV1, AAVrh.10, AAV1R6 or AAV1R7. FIG. 10B. Transduction levels for cardiac (top) and liver (bottom) tissue measured by quantifying relative fluorescence through multiple images taken for each treatment. The bars represent the interval from the smallest to the largest value with the center line representing the average between the samples. Relative fluorescence was normalized for pseudo-treated tissues. Error bars represent standard deviation (/ = 3). One-way ANOVA and two-tailed untested test with Welch correction were performed for each group and the significance in relation to AAVrh.10 is shown. ns, not significant. *, P <0.05.
[00031] FIGS. 11A to H. Rational scheme and functional mapping of a minimum AAVrh.10 footprint to cross the blood-brain barrier. FIG. 11A The sequence alignment of AAV1RX with AAV1 and AAVrh.10 shows the numbered amino acid residues within and
Petition 870190078272, of 8/13/2019, p. 186/335
12/120 adjacent to the neurotropic footprint. Conserved residues are highlighted in yellow, the residues that make up the footprint are highlighted in cyan and non-preserved residues are highlighted either in green or in white. Structural models of the chimeric capsid AAV1RX were generated using the SWISS-MODEL software for homology-based modeling and VIPERdb was used to generate oligomers. PyMol was used to generate superficially rendered models of the AAV1RX VP3 subunit monomer (FIG. 11B), dimer / axis of double symmetry (FIG. 11C), trimer / axis of triple symmetry (FIG. 11 D), pentamer / axis of symmetry quintuple symmetry (FIG. 11E) and the complete capsid (60-mer) (FIG. 11F). Amino acids derived from AAV1 and the homologues between AAV1 and AAVrh.10 are represented in gray while residues comprising the neurotropic footprint of AAVrh.10 to cross the blood-brain barrier are represented in cyan green. FIG. 11G. The projection of the stereographic map shows the neurotropic footprint as viewed below the axis of triple symmetry on the AAV1RX capsid and was generated using RIVEM. Only superficially exposed amino acid residues are shown, with the boundaries between each outlined in black lines. The green regions represent the topological protrusions on the triple symmetry axis while the blue regions represent topological depressions. The main amino acid residues in this footprint are magenta (numbered VP1 AAVrh.10). FIG. 11H. Transduction profile of the central nervous system of AAV1RX that packages a CBh-scGFP transgene administered by injection into the tail vein at a dose of 5 x 10 ¹¹ . vg. Sections taken 21 days after the injection were immunostained and studied by images. Scale bar = 100 μιτι.
[00032] FIGS. 12A to H. Transduction of peripheral tissue and biodistribution of AAV1R6, AAV1R7 and AAV1RX after intravenous administration. The mice were injected through the tail vein
Petition 870190078272, of 8/13/2019, p. 187/335
13/120 with PBS or with the vectors AAV1, AAVrh.10, AAV1R6, AAV1R7 or AAV1RX that pack a CBA-Luc reporter transgene in a dose of 1 x 10 ¹¹ vg. At 2 weeks after injection, levels of luciferase reporter transgene expression (FIGS. 12A, 12C, 12E, 12G) and biodistribution of copies of the viral genome across various tissues (FIG. 12B, 12D, 12F, 12H) were quantified. Luciferase levels have been normalized to grams of tissue lysate and are represented as units of relative light. Copies of the vector genome (vg) are normalized to mouse blade B (mLamB) with an endogenous housekeeping gene and are represented as copies of vg per cell. Error bars represent standard deviation (n = 3 for luciferase assays; n = 4 for biodistribution). One-way ANOVA and a two-tailed two-tailed T-test with Welch correction for each group were performed and the significance in relation to AAVrh.10 is shown. ns, not significant. *, P <0.05.
[00033] FIGS. 13A to H. AAV1RX-mediated levels of neuronal and glial transduction compared to parental and other chimeric capsid variants. The mice received a 5 x 10 vg dose of any parent (AAV1 or AAVrh.10) or chimeric vector that packages a CBh-scGFP transgene by injection into the tail vein. At 3 weeks after the injection, the brains were removed, sectioned, immunostained for GFP and studied by images. The relative levels of neuronal and glial transduction were immunostained for GFP and studied by images. The levels of relative neuronal and glial transduction were quantified by counting the number of neurons and glia transduced, identified based on morphology, for each region by 50 pm coronal section. The levels of AAV1 RX transduction are shown alongside those for the parental serotypes, AAV1 and AAVrh.10, as well as the chimeric variants, AAV1R6 and AAV1R7, across various regions, including the
Petition 870190078272, of 8/13/2019, p. 188/335
14/120 motor cortex (FIG. 13A), cerebral cortex (FIG. 13B), hpocampus (FIG. 13C), toothed gyrus (FIG. 13D), thalamus (FIG. 13E), hypothalamus (FIG. 13F), the striatum (FIG. 13G), and the amygdala (FIG. 13H). Error bars represent the standard deviation (n = 3). A two-tailed two-tailed T-test with Welch correction was used to demonstrate the statistical significance of each group in relation to AAV1. ns: not statistically significant; *, P <0.05. One-way ANOVA was also used to demonstrate that the differences between the means are statistically significant. *, P <0.05 for neuronal and glial transduction across all brain regions shown here.
[00034] FIG. 14. Sequential alignment of the 1RX footprint and Variable Region I (VR-I) among the common AVV serotypes. The sequential alignment of AAV1RX with common AVV serotypes highlights the amino acid residues (VP1 numbering) of the 1RX footprint, within the greater context of the variable region I (VR-I), compared between common natural AVV serotypes. The black lines above and below mark the specific residues within the 1RX footprint. Legend: Residues that are identical between serotypes are represented by red letters on a yellow background; conservative waste, blue letters on a cyan background; similar residues, black letters on a green background; weakly similar residues, green letters on a white background; non-similar waste, black letters on a white background. This sequence alignment was generated using the Vector NTI Advance 11.5.2 software.
[00035] FIG. 15. Alignment of AAV1, AAV1R7, and AAVrh.10 VP1 capsid protein sequences.
DETAILED DESCRIPTION
[00036] Unless otherwise defined, all technical and scientific terms used herein, in this patent application, have the same meaning as commonly understood by one versed in
Petition 870190078272, of 8/13/2019, p. 189/335
15/120 technique to which the present invention belongs. The terminology used here, in this patent application, is for the purpose of describing particular modalities only and is not intended to be limiting. All publications, patent applications, patents, and other references mentioned here, in this patent application, are incorporated by reference here, in this patent application, in its entirety. Definitions
[00037] The following terms are used in the description here, in this patent application, and in the attached claims:
[00038] The forms in the singular "one," "one" and "o", "a" are intended to also include the plural forms, unless the context clearly indicates otherwise.
[00039] Furthermore, the term about, as used herein, in this patent application, when referring to a measurable value such as a quantity of the length of a polynucleotide or polypeptide sequence, dose, time, temperature, and the like, it is intended to encompass variations of ± 20%, ± 10%, ± 5%, ± 1%, ± 0.5%, or even ± 0.1% of the specified quantity.
[00040] Also as used here, in this patent application, and / or refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative (or).
[00041] As used herein, in this patent application, the transitional term consisting essentially of means that the scope of a claim should be interpreted as encompassing the specified materials or steps mentioned in the claim, and those that do not materially affect one or more features basic and new features of the claimed invention. See, In re Herz, 537 F.2d 549, 551-52, 190 USPQ 461, 463 (CCPA 1976) (emphasis on original); see also MPEP § 2111.03. Therefore, the term consisting of essen
Petition 870190078272, of 8/13/2019, p. 190/335
16/120 especially when used in a claim here, in this patent application, it is not intended to be interpreted as being equivalent to comprising.
[00042] Unless the context otherwise indicates, it is specifically intended that the various characteristics of the capsid proteins, vectors, compositions, and methods described herein, in this patent application, can be used in any combination.
[00043] In addition, the present disclosure also contemplates that in some modalities, any characteristic or combination of characteristics stipulated here, in this patent application, can be excluded or omitted.
[00044] In order to further illustrate, if, for example, the specification indicates that a particular amino acid can be selected from A, G, I, L and / or V, this expression also indicates that the amino acid can be selected from any subgroup of these one or more amino acids, for example A, G, I or L; A, G, I or V; A or G; only L; etc. as if each subcombination referred to was expressly stipulated here, in this patent application. In addition, the aforementioned expression also indicates that one or more of the specified amino acids can be rejected. For example, in particular embodiments, the amino acid is not A, G or I; it's not the; it is not G or V; etc. as if each possible waiver was expressly stipulated here, in this patent application.
[00045] As used here, in this patent application, the terms "reduce," "reduce," "reduction" and similar terms indicate a decrease of at least about 25%, 35%, 50%, 75%, 80% , 85%, 90%, 95%, 97% or more, in relation to a control or reference.
[00046] As used here, in this patent application, the terms "increase," increase, "" increase, "" reinforce, "" reinforce, "" reinforcement "and similar terms indicate an increase or reinforcement of at least about
Petition 870190078272, of 8/13/2019, p. 191/335
17/120
5%, 10%, 20%, 25%, 50%, 75%, 100%, 150%, 200%, 300%, 400%, 500% or more, in relation to a control or reference.
[00047] The term "parvovirus" as used here, in this patent application, encompasses the Parvoviridae family, including parvoviruses that replicate autonomously and dependoviruses. Autonomous parvoviruses include members of the genera Parvovirus, Erythrovirus, Densovirus, Iteravirus, and Contravirus. Examples of autonomous parvovirus include, but are not limited to, minute mouse virus, bovine parvovirus, canine parvovirus, chicken parvovirus, feline panleukopenia virus, feline parvovirus, goose parvovirus, H1 parvovirus, muscovy duck parvovirus, B19 virus, and B19, and any other stand-alone parvovirus currently known or discovered later. Other autonomous parvoviruses are known to those skilled in the art. See, for example, BERNARD N. FIELDS et al., VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers).
[00048] As used herein, in this patent application, the term "adeno-associated viruses" (AAV), includes, but is not limited to, AAV type 1, AAV type 2, AAV type 3 (including types 3A and 3B) , AAV type 4, AAV type 5, AAV type 6, AAV type 7, AAV type 8, AAV type 9, AAV type 10, AAV type 10, AAV type 11, AAV type 12, Avian AAV, bovine AAV, canine AAV, Equine AAV, sheep AAV, and any other AAV currently known or discovered later. See, for example, BERNARD N. FIELDS et al., VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers). A number of AVV clades and serotypes have been identified (see, for example, Gao et al. (2004) J. Virology 78: 6381-6388; Moris et al. (2004) Virology 33-: 375-383; and the Table 1).
[00049] The genomic sequences of various AAV serotypes and autonomous parvoviruses, as well as the sequences of native terminal repeats (TRs), Rep proteins, and capsid subunits are known in the art. The sequences referred to can be found 870190078272, from 08/13/2019, p. 192/335
18/120 in the literature or in public databases such as the GenBank® Database. See, for example, GenBank Access Numbers NC_044927, NC_002077, NC_001401, NC_001729, NC_001863, NC_001829, NC_001862, NC_000883, NC_001701, NC_001510, NC_006152, NC_006261, AF0634028, AF90340, U0 X01457, AF288061, AH009962, AY028226, AY028223, NC_001358, NC_001540, AF513851,
AF513852, AY530579; whose disclosures are incorporated by reference here, into this patent application, to teach parvovirus and AAV nucleic acid and amino acid sequences. See also, for example, Srivistava et al. (1983) J. Virology 45: 555; Chiorini et al. (1998) J. Virology 71: 6823; Chiorini et al. (1999) J. Virology 73: 1309; Bantel-Schaal et al. (1999) J. Virology 73: 939; Xiao et al. (1999) J. Virology 73: 3994; Muramatsu et al. (1996) Virology 221: 208; Shade et al. (1986) J. Virol. 58: 921; Gao et al. (2002) Proc. Nat. Acad. Know. USA 99: 11854; Moris et al. (2004) Virology 33-: 375-383; international patent publications Nos. WO 00/28061, WO 99/61601, WO 98/11244; and U.S. Patent No. 6,156,303; whose disclosures are incorporated by reference here, into this patent application, to teach parvovirus and AAV nucleic acid and amino acid sequences. See also Table 1.
[00050] The structures of autonomous AAV and parvovirus capsids are described in more detail in BERNARD N. FIELDS et al., VIROLOGY, volume 2, chapters 69 and 70 (4th ed., LippincottRaven Publishers). See also the description of the crystal structure of AAV2 (Xie et al. (2002) Proc. Nat. Acad. Sci. 99: 10405-10), AAV4 (Padron et al. (2005) J. Virol. 79: 5047- 58), AAV5 (Walters et al. (2004) J. Virol. 78: 3361-71) and CPV (Xie et al. (1996) J. Mol. Biol. 6: 497520; Tsao et al. (1991) Science 251: 1456-64; Drouin et al. (2013) Future Virol. 8 (12): 1183-1199).
Petition 870190078272, of 8/13/2019, p. 193/335
19/120
[00051] The term "tropism" as used here, in this patent application, refers to the preferential entry of the virus into certain cells or tissues, optionally followed by the expression (for example, transcription and, optionally, translation) of one or more sequences carried by the viral genome in the cell, for example, for a recombinant virus, expression of one or more heterologous nucleic acids of interest. Those skilled in the art will recognize that, in some embodiments, transcription of a heterologous nucleic acid sequence from a viral genome cannot be initiated in the absence of transaction factors, for example, to an inducible promoter or sequence of nucleic acid differently regulated. In the case of the genome of a recombinant AAV (rAAV), the genetic expression of the viral genome can be from a stably integrated provirus and / or from a non-integrated episome, as well as any other form that the virus can take inside the cell.
[00052] As used here, in this patent application, systemic tropism and systemic transduction (and equivalent terms) indicate that the virus capsid or virus vector of the disclosure shows tropism for and / or transduces, respectively, tissues throughout the body ( eg brain, lung, skeletal muscle, heart, liver, kidney and / or pancreas). In modalities, systemic transduction of the central nervous system (eg brain, neuronal cells, etc.) is observed. In other modalities, systemic transduction of cardiac muscle tissues is performed.
[00053] Unless otherwise stated, effective transduction or effective tropism, or similar terms, can be determined by reference to adequate control (for example, at least about 50%, 60%, 70%, 80 %, 85%, 90%, 95%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 350%, 400%, 500% or more of transduction or tropism, respectively, control). In modalities
Petition 870190078272, of 8/13/2019, p. 194/335
20/120 particulars, the virus vector transduces effectively or has tropism effective for neuronal cells and cardiomyocytes. Adequate controls will depend on a variety of factors including the desired tropism profile.
[00054] Similarly, it can be determined whether a virus "does not effectively transduce" or "does not have effective tropism" for a target tissue, or similar terms, by reference to adequate control. In particular modalities, the virus vector does not transduce effectively (that is, it has no effective tropism) for the liver, kidney, gonads and / or germ cells. In particular embodiments, the undesirable transduction of one or more tissues (for example, the liver) is 20% or less, 10% or less, 5% or less, 1% or less, 0.1% or less compared to the level of transduction of the one or more target tissues (for example, central nervous system cells; cardiomyocytes).
[00055] As used herein, in this patent application, the term "polypeptide" encompasses both peptides and proteins, unless otherwise indicated.
[00056] A "polynucleotide" is a sequence of nucleotide bases, and can be sequences of RNA, DNA or DNARNA hybrids (including both naturally occurring nucleotides and non-naturally occurring nucleotides), however in representative embodiments they are or sequences of single-stranded or double-stranded DNA.
[00057] As used here, in this patent application, an "isolated" polynucleotide (for example, an "isolated DNA" or an "isolated RNA") means a polynucleotide that is at least partially separated from at least some of the other components of the naturally occurring organism or virus, for example, the cell or viral structural components or other common polypeptides or nucleic acids
Petition 870190078272, of 8/13/2019, p. 195/335
21/120 found in association with the polynucleotide. In representative embodiments, an isolated nucleic acid molecule is enriched at least about 10 times, 100 times, 1000 times, 10,000 times or more compared to the starting material.
[00058] Likewise, an "isolated" polypeptide means a polypeptide that is at least partially separated from at least some of the other naturally occurring components of the organism or virus, for example, the cell or viral structural components or other polypeptides or acids nucleic acids commonly found associated with the polypeptide. In representative embodiments, an "isolated" polypeptide is enriched at least about 10 times, 100 times, 1000 times, 10,000 times or more compared to the starting material.
[00059] As used here, in this patent application, by “isolating” or “purifying” (or grammatical equivalents) a virus vector, it is indicated that the virus vector is at least partially separated from at least some of the other components in the starting material. In representative embodiments, an isolated or purified virus vector is enriched by at least about 10 times, 100 times, 1000 times, 10,000 times or more compared to the starting material.
[00060] As used here, in this patent application, “neuronal cell” includes sensory neurons, pseudo-unipolar neurons, motor neurons, multipolar neurons, interneurons and / or bipolar neurons located in brain substructures, such as the cortex, cortex motor, the hippocampus, the hypothalamus, the striatum, the basal ganglia, the amygdala, the cerebellum, the dorsal root ganglia and / or the spinal cord.
[00061] A "therapeutic protein" is a protein that can relieve, reduce, prevent, delay and / or stabilize symptoms that result from an absence or defect of a protein in a cell or individual
Petition 870190078272, of 8/13/2019, p. 196/335
22/120 and / or is a protein that differently confers a benefit to a subject.
[00062] A "therapeutic RNA molecule" or "functional RNA molecule" as used herein, in this patent application, can be an antisense nucleic acid, a ribozyme (for example, as described in US Patent No. 5,877. 022), an RNA that performs spliceosome-mediated trans-splicing (see, Puttaraju et al. (1999) Nature Biotech. 17: 246; US Patent No. 6,013,487; in US Patent No. 6,083,702), an RNA interfering (RNAi) including siRNA, shRNA or miRNA, which mediates genetic silencing (see, Sharp et al., (2000) Science 287: 2431), and any other untranslated RNA, such as a "guide" RNA (Gorman et al. (1998) Proc. Nat. Acad. Sci. USA 95: 4929; US Patent No. 5,869,248 to Yuan et al.) and the like as are known in the art.
[00063] By the terms "treat," "treating" or "treatment of" (and garmatic variations thereof) it is indicated that the severity of the subject's condition is reduced, at least partially improved or stabilized and / or that some relief is obtained , mitigation, decrease or stabilization in at least one clinical symptom and / or there is a delay in the progression of the disease or disorder.
[00064] The terms prevent, prevent and prevent ”(and garmatic variations thereof) refer to prevention and / or delay in the onset of a disease, disorder and / or one or more clinical symptoms in a subject and / or a reduction in severity of the onset of the disease, the disorder and / or one or more clinical symptoms in relation to what would occur in the absence of the methods of disclosure. Prevention can be complete, for example, the total absence of the disease, the disorder and / or one or more clinical symptoms. Prevention can also be partial, in such a way that the occurrence of the disease, the disorder and / or one or more clinical symptoms in the subject and / or the severity of the onset is
Petition 870190078272, of 8/13/2019, p. 197/335
23/120 lower than would occur in the absence of this disclosure.
[00065] An "effective for treatment" amount as used here, in this patent application, is an amount that is sufficient to provide some improvement or benefit to the subject. In other words, an "effective for treatment" amount is an amount that will provide some relief, mitigation, decrease and / or stabilization in at least one clinical symptom in the subject. Those skilled in the art will recognize that the therapeutic effects need not be complete or curative, as long as some benefit is provided for the subject.
[00066] An "effective prevention amount as used herein, in this patent application, is an amount that is sufficient to prevent and / or delay the onset of a disease, disorder and / or clinical symptoms in a subject and / or to reduce and / or delaying the severity of the onset of a disease, disorder and / or symptoms in a subject in relation to what would occur in the absence of the methods of disclosure. Those skilled in the art will recognize that the level of prevention need not be complete, as long as some benefit is provided for the subject.
[00067] The terms "heterologous nucleotide sequence" and "heterologous nucleic acid molecule" are used interchangeably here, in this patent application, and refer to a naturally occurring nucleic acid molecule and / or nucleotide sequence in the virus. In general, the heterologous nucleic acid molecule or heterologous nucleotide sequence comprises an open reading frame encoding a protein or an untranslated RNA of interest (for example, for release to a cell or subject).
[00068] As used here, in this patent application, the terms "virus vector," "vector" or "gene release vector" refer to a virus particle (for example, AAV) that functions as a vehicle
Petition 870190078272, of 8/13/2019, p. 198/335
24/120 nucleic acid release cell, which comprises the genome of the vector (for example, viral DNA [vDNA]) packaged within a virion. Alternatively, in some contexts, the term "vector" can be used to refer to the genome of the isolated vector / vDNA.
[00069] A "rAAV vector genome" or "rAAV genome" is a recombinant AAV genome (i.e., vDNA) comprising one or more heterologous nucleic acid sequences. RAAV vectors generally require only one or more repetitions of terminals (TR (s)) in cis to generate viruses. All other viral sequences are dispensable and can be supplied in trans (Muzyczka (1992) Curr. Topics Microbiol. Immunol. 158: 97). Typically, the genome of the rAAV vector will only conserve one or more TR sequences in order to maximize the size of the transgene that can be effectively packaged by the vector. Structural and non-structural protein coding sequences can be provided in trans (for example, from a vector, such as a plasmid, and / or stably integrating the sequences within the packaging cell). In embodiments, the genome of the rAAV vector comprises at least one terminal repeat sequence (TR) (for example, AAV TR sequence), optionally two TRs (for example, two AAV TRs), which will typically be at the 5 'ends and 3 'of the vector genome and flank the heterologous nucleic acid sequence, but need not be contiguous to that. The TRs can be the same or different from each other.
[00070] The term “terminal repetition” or TR includes any viral terminal repetition or synthetic sequence that forms a hairpin structure and functions as an inverted terminal repetition (that is, it mediates the desired functions such as replication, virus packaging, provirus integration and / or rescue, and the like). The TR can be an AAV TR or a non-AAV TR.
Petition 870190078272, of 8/13/2019, p. 199/335
25/120
For example, a sequence of non-AAV TRs such as those of other parvoviruses (for example, canine parvovirus (CPV), mouse parvovirus (MVM), human parvovirus B-19) or any other suitable virus sequence (for example, example, the SV40 hairpin that serves as the SV40 origin of replication) can be used as a TR, which can later be modified by truncation, substitution, deletion, insertion and / or addition. In addition, TR can be partially or completely synthetic, such as the "double D sequence" as described in US Patent No. 5,478,745 to Samulski et al.
[00071] An "AAV terminal repeat" or AAV TR can be of any AAV, including but not limited to serotypes 1, 2, 3, 4, 5,6,7,8,9,10,11,12 or any other AAV currently known or discovered later (see, for example, Table 1). An AAV terminal repeat does not need to have the native terminal repeat sequence (for example, a native AAV TR sequence can be altered by insertion, deletion, substitution, truncation and / or missense mutations), as long as the repetition of terminal mediates the desired functions, for example, replication, virus packaging, integration, and / or rescue of provirus, and the like.
[00072] The virus vectors of the disclosure may additionally be "targeted" virus vectors (for example, having a targeted tropism) and / or a "hybrid" parvovirus (ie, in which the viral TRs and the viral capsid are of different parvoviruses) as described in the international patent publication WO 00/28004 and in Chao et al. (2000) Molecular Therapy 2: 619.
[00073] The virus vectors of the disclosure may additionally be duplexed parvovirus particles as described in international patent publication WO 01/92551 (the disclosure of which is incorporated herein, in this patent application, by reference in its entirety). Thus, in some modalities, genomes of ca
Petition 870190078272, of 8/13/2019, p. 200/335
26/120 double deia (duplex) can be packaged inside the virus capsids of the disclosure.
[00074] In addition, the viral capsid or genomic elements may contain other modifications, including insertions, deletions and / or substitutions.
[00075] As used here, in this patent application, the term "amino acid" encompasses any naturally occurring amino acid, modified forms of it, and synthetic amino acids.
[00076] Levorotatory (L-) naturally occurring amino acids are shown in Table 3.
[00077] In addition, the naturally occurring amino acid may be an unnatural amino acid as described by Wang et al. Annu Rev Biophys Biomol Struct. 35: 225-49 (2006)). These unnatural amino acids can be used advantageously to chemically link molecules of interest to the AAV capsid protein.
Modified AAV Capsid Proteins and Virus Capsids and Virus Vectors Understanding the Same.
[00078] The present disclosure provides AAV capsid proteins comprising a mutation (i.e., a modification, which may be a substitution or insertion or deletion) in the amino acid and capsid sequence of viruses and virus vectors comprising the protein of the modified AAV capsid. The mutated AAV capsid proteins, and the nucleic acids encoding them, are not found in nature (that is, they are unnatural) and neither have the sequence of wild-type sequences found in nature nor the function of those sequences. Instead, the inventors have found that modifications in the amino acid positions described here, in this patent application, can confer one or more desirable properties for virus vectors comprising the modified AAV capsid protein including without limitation: (i) transduction
Petition 870190078272, of 8/13/2019, p. 201/335
27/120 selective neuronal cells after crossing the blood-brain barrier after systemic injection; (ii) simultaneous transduction of cardiac and neuronal tissue after systemic injection; and (iii) detargeting from the liver, spleen, kidney and other peripheral organs. [00079] In particular embodiments, the modified AAV capsid protein of the disclosure comprises one or more mutations (i.e. modifications) in the amino acid sequence of the native AAV1 capsid protein or the corresponding one or more amino acid residues of a protein of the capsid from another AAV serotype, including but not limited to AAV2, AAV3, AAV6, AAV7, AAV8, AAV9 and AAVrh.10. The amino acid positions in other AVV serotypes or modified AVV capsids that correspond to these positions in the native AAV1 capsid protein will be evident to those skilled in the art and can be readily determined using sequence alignment techniques (see, for example) , Figure 7 of international patent document No. WO 2006/066066) and / or structure of crystal analysis (Padron et al. (2005) J. Virol. 79: 504758).
[00080] Those skilled in the art will recognize that, for some AAV capsid proteins, the corresponding modification will be an insertion and / or a substitution, depending on whether the corresponding amino acid positions are partially or completely present in the virus or, alternatively , are completely absent. Likewise, when modifying AAVs other than AAV1, the one or more specific amino acid positions may differ from the position in AAV1 (using the numbering VP1. As discussed elsewhere here, in this patent application, to one or more positions of corresponding amino acids will be readily apparent to those skilled in the art using commonly known techniques.
[00081] As used here, in this patent application, a “mutation
Petition 870190078272, of 8/13/2019, p. 202/335
28/120 tion ”or“ modification ”in an amino acid sequence includes substitutions, insertions and / or deletions, each of which may involve one, two, three, four, five, six, seven, eight, nine, ten or more amino acids. In particular modalities, the modification is a substitution. In other embodiments, the modification is an insertion (for example, of a single amino acid residue between two amino acid residues in an amino acid sequence.)
[00082] Therefore, in one embodiment, the present disclosure provides an adeno-associated virus (AAV) capsid protein, in which the AAV capsid protein comprises, consists essentially of, or consists of a modification in the S262 amino acid residues, A263, S264, T265, A267, and S268, and a single insertion of amino acid residue between residues 266 and 267 (numbering VP1), where the numbering of each residue is based on the amino acid sequence of AAV1 (SEQ ID NO: 1) or the equivalent amino acid residue in AAV2 (SEQ ID NO: 2), AAV3 (SEQ ID NO:
3), AAV6 (SEQ ID NO: 4), AAV7 (SEQ ID NO: 5), AAV8 (SEQ ID NO:
6), AAV9 (SEQ ID NO: 7) or AAVrhW (SEQ ID NO: 8). In some embodiments, the AAV capsid protein may comprise a modification in the H272 amino acid residue. In particular modalities, the modification is S262N, A263G, S264T, T265S, A267S, S268T, H272T, and combinations thereof. In particular embodiments, the only insertion of an amino acid residue between residues 266 and 267 is G (designated -267G).
[00083] In some embodiments, the AAV capsid protein described above may additionally comprise, consist essentially of or consist of a modification in amino acid residues Q148, E152, S157, T162, H272, T326, D328, V330, T331, V341 and S345, and a single insertion of amino acid residue between residues 152 and 153 (numbering VP1), where the numbering of each residue
Petition 870190078272, of 8/13/2019, p. 203/335
29/120 duo is based on the amino acid sequence of SEQ ID NO: 1 or the equivalent amino acid residue in SEQ ID NOs: 2, 3, 4, 5, 6, 7 or 8. In particular embodiments, the modification is Q148P, E152R, S157T, T162K, H272T, T326Q, D328E, V330T, T331K, V341I and S345T. In particular embodiments, the only insertion of amino acid residue between residues 152 and 153 is S (designated -153S).
[00084] In some embodiments, the AAV capsid protein described above may additionally comprise, consist essentially of or consist of a modification of amino acid residues L188, S205, N223, A224, and H272 (VP1 numbering), where the numbering of each residue is based on the amino acid sequence of SEQ ID NO: 1 or the equivalent amino acid residue in SEQ ID NOs: 2, 3, 4, 5, 6, 7 or 8. In particular embodiments, the modification is L188I, S205A , N223S, A224S, and H272T.
[00085] In some embodiments, the present invention provides an adeno-associated virus (AAV) capsid protein, wherein the AAV capsid protein comprises, consists essentially of, or consists of a modification in the amino acid residues S262, A263 , S264, T265, and A267 (VP1 numbering), and a single insertion of amino acid residue between residues S268 and N269, where the numbering of each residue is based on the amino acid sequence of AAV1 (SEQ ID NO: 1) or the equivalent amino acid residue in AAV2 (SEQ ID NO: 2), AAV3 (SEQ ID NO: 3), AAV6 (SEQ ID NO: 4), AAV7 (SEQ ID NO: 5), AAV8 (SEQ ID NO: 6) , AAV9 (SEQ ID NO: 7) or AAVrhIO (SEQ ID NO: 8). In some embodiments, the modification is at least one for S262N, A263G, S264T, T265S, and A267S. In some embodiments, the AVV capsid may additionally comprise, consist essentially of, or consist of a modification in the amino acid residue H272. In some embodiments, AAV capsid protein may additionally purchase
Petition 870190078272, of 8/13/2019, p. 204/335
30/120 address, consist essentially of, or consist of, a modification in the amino acid residues Q148, E152, S157, T162, H272, T326, D328, V330, T331, V341 and S345, and a single insertion of amino acid residue between waste E152 and P153. In some embodiments, the AAV capsid protein additionally comprises a modification in the amino acid residues L188, S205, N223, A224, and H272. In some embodiments, the modification is at least one for L188I, S205A, N223S, A224S and H272T. In some embodiments, the insertion of amino acid residue between residues S268 and N269 is an insertion of a single residue T. In some embodiments, the insertion of amino acid residue between residues E152 and P153 is an insertion of a single residue S.
[00086] In some embodiments, the present invention provides an adeno-associated virus (AAV) capsid protein, wherein the AAV capsid protein comprises, consists of, or consists essentially of a modification resulting in the amino acid sequence: X ¹ -X ² -X ³ -X ⁴ (SEQ ID NO: 35) in amino acids corresponding to amino acid positions 262 to 265 (VP1 numbering) of the native AAV1 capsid protein (SEQ ID NO: 1), where X ¹ is any amino acid other than S; where X ² is any amino acid other than A; where X ³ is any amino acid other than S; and where X ⁴ is any amino acid other than T.
[00087] In some embodiments, amino acid X ¹ is N, amino acid X ² is G, amino acid X ³ is T, or amino acid X ⁴ is S. In some embodiments, amino acid X ¹ is N, amino acid X ² is G, amino acid X ³ is T, and amino acid X ⁴ is S. In some embodiments, the AAV capsid protein additionally comprises a modification in the amino acid residue H272. In some embodiments, the modification is H272T. In some embodiments, the AAV capsid protein additionally comprises an
Petition 870190078272, of 8/13/2019, p. 205/335
31/120 amino acid between the S268 and N269 amino acid residues. In some embodiments, the insertion of an amino acid residue is an insertion of a single T residue.
[00088] In some embodiments, the present invention provides an adeno-associated virus (AAV) capsid protein, wherein the AAV capsid protein comprises, consists essentially of, or consists of a modification in the amino acid residues S262, A263 , S264, T265, A267, and H272, and a single insertion of amino acid residue between residues S268 and N269, (VP1 numbering), where the numbering of each residue is based on the amino acid sequence of AAV1 (SEQ ID NO: 2) or the equivalent amino acid residue in AAV1 (SEQ ID NO: 1), AAV3 (SEQ ID NO: 3), AAV6 (SEQ ID NO: 4), AAV7 (SEQ ID NO: 5), AAV8 (SEQ ID NO : 6), AAV9 (SEQ ID NO: 7) or AAVrhIO (SEQ ID NO: 8). In some embodiments, the modification comprises at least one of S262N, A263G, S264T, T265S, A267G, and H272T. In some embodiments, the only natural amino acid residue insertion between residues S268 and N269 is an insertion of a single T residue.
[00089] In some embodiments, the present invention provides an adeno-associated virus (AAV) capsid protein, wherein the AAV capsid protein comprises, consists essentially of, or consists of a modification in the amino acid residues S262, Q263 , S264, A266, S267, and H271, and an insertion of at least one amino acid residue between residues S261 and S262, (VP1 numbering), where the numbering of each residue is based on the amino acid sequence of AAV2 (SEQ ID NO: 2) or the equivalent amino acid residue in AAV1 (SEQ ID NO: 1), AAV3 (SEQ ID NO: 3), AAV6 (SEQ ID NO: 4), AAV7 (SEQ ID NO: 5), AAV8 (SEQ ID NO:
6), AAV9 (SEQ ID NO: 7) or AAVrhIO (SEQ ID NO: 8). In some modalities, the modification comprises at least one of S262T,
Petition 870190078272, of 8/13/2019, p. 206/335
32/120
Q263S, S264G, A266S, S267T, and H271T. In some embodiments, the insertion between residues SS61 and S262 is an insertion of a single amino acid residue. In some embodiments, the insertion between residues S251 and S252 is an insertion of more than one amino acid residue. In some embodiments, the insertion between residues S251 and S252 is an insertion of residue N and G.
[00090] In some embodiments, the present invention provides an adeno-associated virus (AAV) capsid protein, wherein the AAV capsid protein comprises, consists essentially of, or consists of a modification in the amino acid residues
5262, Q263, S264, A266, A267, H271, and a single amino acid residue insert between residues S261 and S262, where the numbering of each residue is based on the amino acid sequence of AAV3 (SEQ ID NO: 3) or the equivalent amino acid residue in AAV1 (SEQ ID NO: 1), AAV2 (SEQ ID NO: 2), AAV6 (SEQ ID NO: 4), AAV7 (SEQ ID NO: 5), AAV8 (SEQ ID NO: 6) , AAV9 (SEQ ID NO: 7) or AAVrhIO (SEQ ID NO: 8). In some embodiments, the modification comprises at least one of S262T, Q263S, S264G, A266S, A267T, H271T. In some embodiments, the insertion between residues SS61 and S262 is an insertion of a single amino acid residue, or more than one amino acid residue. In some embodiments, the insertion between residues S251 and S252 is an insertion of residue N and G.
[00091] In some embodiments, the present invention provides an adeno-associated virus (AAV) capsid protein, wherein the AAV capsid protein comprises, consists essentially of, or consists of a modification in the amino acid residues
5263, S269, A237 (VP1 numbering), where the numbering of each residue is based on the amino acid sequence of AAV9 (SEQ ID NO: 9) or the equivalent amino acid residue in AAV1 (SEQ ID NO:
Petition 870190078272, of 8/13/2019, p. 207/335
33/120
1), AAV2 (SEQ ID NO: 2), AAV3 (SEQ ID NO: 3), AAV6 (SEQ ID NO:
4), AAV7 (SEQ ID NO: 5), AAV8 (SEQ ID NO: 6), or AAVrhIO (SEQ ID NO: 8). In some embodiments, the modification comprises at least one of S263G, S269T, and A273T.
[00092] In some embodiments, the present invention provides an adeno-associated virus (AAV) capsid protein, wherein the AAV capsid protein comprises, consists essentially of, or consists of, the sequence of any one of SEQ ID NO: 9 to SEQ ID NO: 34.
[00093] Non-limiting examples of modifications to produce the capsid proteins of this disclosure in AVV serotypes 1,2, 3, 6, 7, 8, and 9, respectively, are shown in Table 2, in which the residues of equivalent amino acids in the respective AVV serotypes.
[00094] In additional embodiments, the capsid proteins of this disclosure may comprise, consist essentially of, or consist of: the amino acid sequence of SEQ ID NO: 9 (AAV1RX); the amino acid sequence of SEQ ID NO: 10 (AAV2RX); the amino acid sequence of SEQ ID NO: 11 (AAV3RX); the amino acid sequence of SEQ ID NO: 12 (AAV6RX); the amino acid sequence of SEQ ID NO: 13 (AAV7RX); the amino acid sequence of SEQ ID NO: 14 (AAV8RX); the amino acid sequence of SEQ ID NO: 15 (AAV9RX); the amino acid sequence of SEQ ID NO: 16 (AAV1R6); the amino acid sequence of SEQ ID NO: 17 (AAV2R6); the amino acid sequence of SEQ ID NO: 18 (AAV3R6); the amino acid sequence of SEQ ID NO: 19 (AAV6R6); the amino acid sequence of SEQ ID NO: 20 (AAV7R6); the amino acid sequence of SEQ ID NO: 21 (AAV8R6); the amino acid sequence of SEQ ID NO: 22 (AAV9R6); the amino acid sequence of SEQ ID NO: 23 (AAV1R7); the amino acid sequence of SEQ ID NO: 24 (AAV2R7); the sequence
Petition 870190078272, of 8/13/2019, p. 208/335
34/120 amino acid copies of SEQ ID NO: 25 (AAV3R7); the amino acid sequence of SEQ ID NO: 26 (AAV6R7); the amino acid sequence of SEQ ID NO: 27 (AAV7R7); the amino acid sequence of SEQ ID NO: 28 (AAV8R7); and the amino acid sequence of SEQ ID NO: 29 (AAV9R7). In one embodiment, a capsid protein of this disclosure has the amino acid sequence of SEQ ID NO: 9 (AAV1RX). In one embodiment, a capsid protein of this disclosure has the amino acid sequence of SEQ ID NO: 16 (AAV1R6). In one embodiment, a capsid protein of this disclosure has the amino acid sequence of SEQ ID NO: 23 (AAV1R7).
[00095] In some modalities, the present disclosure provides AAV capsid proteins having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, including all bands and sub-bands between the same, of sequence identity with the amino acid sequence of SEQ ID NO: 9 (AAV1RX); the amino acid sequence of SEQ ID NO: 10 (AAV2RX); the amino acid sequence of SEQ ID NO: 11 (AAV3RX); the amino acid sequence of SEQ ID NO: 12 (AAV6RX); the amino acid sequence of SEQ ID NO: 13 (AAV7RX); the amino acid sequence of SEQ ID NO: 14 (AAV8RX); and the amino acid sequence of SEQ ID NO: 15 (AAV9RX).
[00096] In some modalities, the present disclosure provides AAV capsid proteins having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, including all bands and sub-bands between the same, of sequence identity with the amino acid sequence of SEQ ID NO: 16 (AAV1R6); the amino acid sequence of SEQ ID NO: 17 (AAV2R6); the amino acid sequence of SEQ ID NO: 18 (AAV3R6); the amino acid sequence of SEQ ID NO: 19 (AAV6R6); the amino acid sequence of SEQ ID NO: 20 (AAV7R6); the amino acid sequence
Petition 870190078272, of 8/13/2019, p. 209/335
35/120 of SEQ ID NO: 21 (AAV8R6); and the amino acid sequence of SEQ ID NO: 22 (AAV9R6).
[00097] In some modalities, the present disclosure provides AAV capsid protein having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, including all bands and sub-bands between the same, of sequence identity with the amino acid sequence of the amino acid sequence of SEQ ID NO: 23 (AAV1R7); the amino acid sequence of SEQ ID NO: 24 (AAV2R7); the amino acid sequence of SEQ ID NO: 25 (AAV3R7); the amino acid sequence of SEQ ID NO: 26 (AAV6R7); the amino acid sequence of SEQ ID NO: 27 (AAV7R7); the amino acid sequence of SEQ ID NO: 28 (AAV8R7); and the amino acid sequence of SEQ ID NO: 29 (AAV9R7).
[00098] The present disclosure also provides an adeno-associated virus (AAV) capsid protein, wherein the AAV capsid protein comprises one or more substitutions in all positions or in any combination of less than all positions, resulting in the amino acid sequence: X ¹ -X ² -X ³ -X ⁴ (SEQ ID NO: 35). In some embodiments, the modification of the amino acid sequence: X ¹ -X ² -X ³ -X ⁴ is in the amino acids corresponding to amino acid positions 262 to 265 (VP1 numbering) of the native AAV1 capsid protein (SEQ ID NO: 1 ). In some embodiments, X ¹ may be any amino acid other than S. In some embodiments, X ² may be any amino acid other than A. In some embodiments, X ³ may be any amino acid other than S. In some embodiments, X ⁴ may be any amino acid other than T. In one embodiment, amino acid X ¹ is N. In one embodiment, amino acid X ² is G. In one embodiment, amino acid X ³ is T. In one embodiment, amino acid X ⁴ is S. In another modality, X ¹ is N, X ² is G, X ³ is T, and X ⁴ is S. In some modalities, one from X ¹ to X ^{4 is} not
Petition 870190078272, of 8/13/2019, p. 210/335
36/120 is substituted, and the amino acid residue in the unsubstituted position is the wild-type amino acid residue.
[00099] Examples of amino acid residues that can be replaced by the native amino acid at the respective positions described here, in this patent application, are set out in Table 3.
[000100] It should be understood that the substitutions and insertions described in the AAV capsid proteins of this disclosure may include substitutions and / or insertions with conservative amino acid residues. Said conservative substitutions are well known in the art and include, for example, the non-polar amino acids Gly, Ala, Val, Leu, Ile, Met, Phe, Trp and Pro can be substituted for each other; the polar amino acids Ser, Thr, Cys, Tyr, Asn and Gin can be substituted for each other; the negatively charged amino acids Asp and Glu can be substituted for each other; and the positively charged amino acids Lys, Arg and His can be substituted for each other, in any combination.
[000101] The present disclosure also provides an AVV capsid comprising a capsid protein from this disclosure as well as a virus vector comprising an AVV capsid from this disclosure. In some embodiments, the virus vector may comprise, essentially consist of, or consist of a virus vector comprising: an AVV capsid of this disclosure; and a nucleic acid molecule comprising at least one terminal repeat sequence, in which the nucleic acid is encapsulated by the AVV capsid. In some embodiments, the repetition of the terminal is a repetition of the AAV terminal. In some embodiments, the repetition of the terminal is a repetition of the non-AAV terminal.
[000102] Also provided herein, in this patent application, is a composition comprising the capsid protein and / or virus vector of this disclosure in a pharmaceutically acceptable carrier.
Petition 870190078272, of 8/13/2019, p. 211/335
37/120
[000103] Various methods are also provided in the present invention, including a method of introducing a nucleic acid molecule into a cell, comprising contacting the cell with the virus vector and / or the composition of this disclosure, for example, under conditions for whereby the virus vector is carried into the cell or internalized by the cell and a nucleic acid molecule introduced via the virus vector is expressed in the cell.
[000104] Also provided in this patent application is a method of releasing a nucleic acid molecule to a subject, comprising administering to the subject the virus vector and / or the composition of this disclosure. In particular modalities, the virus vector and / or composition is administered to the subject's central nervous system. In particular modalities, the virus vector and / or composition is released through the blood-brain barrier.
[000105] In some embodiments, the virus vector in this disclosure may comprise a nucleic acid molecule of interest. In some embodiments, the nucleic acid molecule of interest can encode a therapeutic RNA molecule or a therapeutic protein.
[000106] The present disclosure also provides a method of selectively releasing a nucleic acid molecule of interest to a neuronal cell, comprising contacting the neuronal cell with the virus vector of this disclosure, wherein the virus vector comprises the nucleic acid molecule of interest. In additional embodiments, the method may further comprise selectively releasing a nucleic acid molecule of interest to a cardiomyocyte, for example, when the method is performed on a subject (for example, a human subject). In some embodiments, the composition is selectively released to a neuronal cell. In some embodiments, the composition is selectively released to a cardiomyocyte.
Petition 870190078272, of 8/13/2019, p. 212/335
38/120
[000107] In additional embodiments, the present disclosure provides a method of treating a neurological disorder or defect in a subject, comprising administering to the subject the virus vector of this disclosure, wherein the virus vector comprises a nucleic acid molecule that encodes a therapeutic protein or therapeutic RNA effective in treating neurological defect or disorder.
[000108] Additionally, a method of treating a neurological and cardiovascular disorder or defect in a subject is provided herein, comprising administering to the subject the virus vector of this disclosure, wherein the virus vector comprises a molecule of nucleic acid encoding a therapeutic protein or therapeutic RNA effective in the treatment of neurological and cardiovascular disorder or defect.
[000109] In the methods described here, in this patent application, the virus vector and / or composition of this disclosure can be administered / released to a subject in this disclosure through a systemic route (for example, intravenously, intravenously) arterial, intraperitoneal, etc.). In some embodiments, the virus vector and / or composition can be administered to the subject via an intracerebroventrical, intracisternal, intraparenchymal, intracranial and / or intrathecal route.
[000110] In some embodiments, systemic administration of the virus vector and / or composition to the subject results in less transduction in off-target tissues (for example, different from the central nervous system). In some embodiments of this disclosure, the virus vector is detargeted from the spleen, liver, and / or kidney. In some embodiments, the virus vector is detargeted from splenocytes, hepatocytes and / or kidney cells. In some embodiments, the virus vector transduces the liver, spleen, and / or kidney to a level that is reduced by at least
Petition 870190078272, of 8/13/2019, p. 213/335
39/120 minimum 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99 % or 100% compared to transduction by AAVrh.10, where viral transduction is optionally determined by expression of luciferase or GFP. Preferably, the virus vector transduces the liver, spleen, and / or kidney to a level that is reduced by at least 50% to 100%, or 80 to 90% compared to transduction by AAVrh.10, where viral transduction is optionally determined by expression of luciferase or GFP.
[000111] In some embodiments, the virus vector transduces the brain at a level that is increased by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% compared to AAV1 transduction, where viral transduction is optionally determined by expression of luciferase or GFP. Preferably, the virus vector transduces the brain at a level that is increased by at least 2 times, 2.5 times, 3 times, 4 times, 4.5 times, 5 times, 5.5 times, 6 times, 6.5 times, 7 times, 7.5 times, 8 times, 8.5 times, 9 times, 9.5 times, or 10 times compared to AAV1 transduction, where viral transduction is optionally determined by luciferase expression or GFP. In some embodiments, the virus vector selectively transduces neurons.
[000112] The present invention contemplates that the modified capsid proteins of the disclosure can be produced by modifying the capsid protein of any AAV currently known or discovered later. In addition, the AAV capsid protein that must be modified may be a naturally occurring AAV capsid protein (for example, an AAV2, AAV3a or 3b, AAV6, AAV7, AAV8, AAV9, AAVrh.10 or any of the AVV serotypes shown in Table 1), but is not limited to these. Those skilled in the art will understand that a variety of manipulations for
Petition 870190078272, of 8/13/2019, p. 214/335
40/120 AAV capsid proteins are known in the art and the present invention is not limited to naturally occurring modifications of AAV capsid proteins. For example, the capsid protein to be modified may already have modifications compared to naturally occurring AAV (for example, it is derived from a naturally occurring AAV capsid protein, for example, AAV2, AAV3a, AAV3b, AAV4 , AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 and / or AAV12 or any other AAV currently known or discovered later). The AAV capsid proteins referred to are also within the scope of the present disclosure.
[000113] Therefore, in particular embodiments, the AAV capsid protein to be modified can be derived from a naturally occurring AAV but can additionally comprise one or more foreign sequences (for example, which are exogenous to the native virus) that are inserted and / or replaced within the capsid protein and / or that have been altered by deletion of one or more amino acids.
[000114] Therefore, when referring here, in this patent application, to a specific AAV capsid protein (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 or AAV12 or a capsid protein from any of the AVV serotypes shown in Table 1, etc.), is intended to encompass native capsid protein as well as capsid proteins that have changes other than the disclosure modifications. The changes referred to include substitutions, insertions and / or deletions. In particular embodiments, the capsid protein may comprise 1,2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, less than 20, less than 30, less than 40 less than 50, less than 60, or less than 70 amino acids inserted in it (different from the inserts in this disclosure) compared to section 870190078272, of 13/08/2019, p. . 215/335
41/120 native AAV capsid protein sequence. In disclosure modalities, the capsid protein may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 , less than 20, less than 30, less than 40 less than 50, less than 60, or less than 70 amino acid substitutions (other than the amino acid substitutions according to the present invention) compared to the protein sequence of the capsid of the Native AAV. In embodiments, the capsid protein may comprise a deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, less than 20, less than 30, less than 40 less than 50, less than 60, or less than 70 amino acids (different from the amino acid deletions in the disclosure) compared to the native AAV capsid protein sequence.
[000115] In particular embodiments, the AAV capsid protein has the native AAV capsid protein sequence or has an amino acid sequence that is at least about 90%, 95%, 97%, 98% or 99% similar or identical to a native AAV capsid protein sequence. For example, in particular embodiments, a capsid protein AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, etc. encompasses the protein sequence of the AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12 native capsid as well as sequences that are at least about 80%, 85%, 90%, 95 %, 97%, 98% or 99% similar or identical to the protein sequence of the AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV11, AAV12 capsid protein.
[000116] Methods for determining sequence similarity or identity between two or more amino acid sequences are known in the art. Sequence similarity or identity can be determined using routine techniques known in the art, in
Petition 870190078272, of 8/13/2019, p. 216/335
42/120 including, but not limited to, the local sequence identity algorithm of Smith and Waterman, Adv. Appl. Math. 2, 482 (1981), by Needleman and Wunsch J. Mol. Biol. 48,443 (1970), by the similarity study method of Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85,2444 (1988), for computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Drive, Madison, Wl), the Best Fit sequence program described by Devereux et al. Nucl. Acid Res. 12, 387-395 (1984), or by inspection.
[000117] Another suitable algorithm is the BLAST algorithm, described in Altschul et al. J. Mol. Biol. 215, 403-410, (1990) and Karlin et al. Proc. Natl. Acad. Sci. USA 90, 5873-5787 (1993). A particularly useful BLAST program is the WU-BLAST-2 program, which was obtained from Altschul et al. Methods in Enzymology, 266, 460-480 (1996); http: //blast.wustl/edu/blast/ README.html. WU-BLAST-2 uses several search parameters, which are optionally set to the default values.
[000118] In addition, an additional useful algorithm is BLAST with gapped as reported by Altschul et al., (1997) Nucleic Acids Res. 25, 3389-3402.
[000119] The modified virus capsids can be used as "capsid vehicles," as described, for example, in US Patent No. 5,863,541. Molecules that can be packaged by the modified virus capsid and transferred into a cell include heterologous DNA, RNA, polypeptides, small organic molecules, metals, or combinations thereof.
[000120] Heterologous molecules are defined as those that are not found naturally in an AAV infection, for example, those not encoded by a wild AAV genome. In addition, molecule
Petition 870190078272, of 8/13/2019, p. 217/335
43/120 therapeutically useful gels can be associated with the exterior of the chimeric virus capsid for transfer of pear molecules within target host cells. The associated associated molecules can include DNA, RNA, small organic molecules, metals, carbohydrates, lipids and / or polypeptides. In one embodiment of the disclosure, a therapeutically useful molecule is covalently linked (i.e., conjugated or chemically coupled) to the capsid proteins. Methods for covalently binding molecules are known to those skilled in the art.
[000121] The modified virus capsids of the disclosure also find use as models for further modification of antigenicity to prevent neutralizing antibodies in any mammalian serum, as described, for example, in PCT International Serial Patent Application No. PCT / 2016/054143 .
[000122] The modified virus capsids of the disclosure also find use in creating antibodies against the new capsid structures. As an additional alternative, an exogenous amino acid sequence can be inserted into the modified virus capsid for presenting antigen to a cell, for example, for administration to a subject to produce an immune response to the exogenous amino acid sequence.
[000123] In other embodiments, virus capsids can be administered to block some cell sites prior to and / or concomitantly with (for example, within minutes or hours of each other) administration of a virus vector releasing an acid molecule nucleic encoding a polypeptide, peptide and / or functional RNA of interest. For example, the capsids of the invention can be released to block cell receptors on particular cells and a release vector can be administered thereafter or concurrently, which can reduce the transduction of the blocked cells.
Petition 870190078272, of 8/13/2019, p. 218/335
44/120 das, and reinforce the transduction of other targets.
[000124] According to representative modalities, modified virus capsids can be administered to a subject before and / or concurrently with a virus vector modified in accordance with the present disclosure. In addition, the present invention provides pharmaceutical compositions and formulations comprising the modified virus capsids of the invention; optionally, the composition also comprises a modified virus vector of the disclosure.
[000125] The present invention also provides nucleic acid molecules (optionally, isolated nucleic acid molecules) encoding the modified virus capsids and capsid proteins of the disclosure. Additionally, vectors are provided comprising the nucleic acid molecules and cells (in vivo or in culture) comprising the nucleic acid molecules and / or vectors of the disclosure. Suitable vectors include, without limitation, viral vectors (e.g., adenovirus, AAV, herpes virus, alphavirus, vaccinia, poxvirus, baculovirus, and the like), plasmids, phage, YACs, BACs, and the like. The mentioned nucleic acid molecules, vectors and cells can be used, for example, as reagents (for example, packaging aid constructs or packaging cells) for the production of modified virus capsids or virus vectors as described here , in this patent application.
[000126] Virus capsids according to the present invention can be produced using any method known in the art, for example, by expression of a baculovirus (Brown et al. (1994) Virology 198: 477-488).
[000127] The modifications to the AAV capsid protein according to the present disclosure are selective modifications. This approach is in contrast to previous work with an entire subunit or large-domain exchanges between AVV serotypes (see, for
Petition 870190078272, of 8/13/2019, p. 219/335
45/120 example, international patent publication No. WO 00/28004; Hauck et al. (2003) J. Virology 77: 2768-2774; Shen et al. (2007) Mol Ther. 15 (11): 1955-62: and Mays et al. (2013) J Virol. 87 (17): 9473-85). The AAV capsid proteins in this disclosure are, to the knowledge of the inventors, the first examples of specific amino acid modifications to allow crossing the blood-brain barrier. [000128] In some embodiments, an AAV capsid protein contains specific amino acid modifications that allow it to cross the blood-brain barrier. In some embodiments, the AAV capsid protein comprises substitutions of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 amino acids, where the substituted amino acids are derived from AAVrh.10, in which the amino acid substitutions allow to cross the blood-brain barrier. In some embodiments, the AAV capsid protein is derived from an AAV1 capsid protein, and comprises substitutions of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 amino acids, where the substituted amino acids are derived from AAVrh.10, where the amino acid substitutions allow to cross the blood-brain barrier. In some modalities, the specific amino acids that allow crossing the blood-brain barrier are 262N, 263G, 264T, 265S, 267G, 268S, 269T and 273T (VP1 numbering), where the numbering of each residue is based on the amino acid sequence of SEQ ID NO: 9 or SEQ ID NO: 30.
[000129] In some embodiments, an AAV capsid protein contains specific amino acid modifications that allow detargeting from the liver, kidney, and / or spleen. In some embodiments, the AAV capsid protein comprises substitutions of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 amino acids, where the substituted amino acids are derived from AAVrh.10, where amino acid substitutions allow detargeting from
Petition 870190078272, of 8/13/2019, p. 220/335
46/120 of the liver, kidney, and / or spleen. In some embodiments, the AAV capsid protein is derived from an AAV1 capsid protein, and comprises 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 amino acids, where the substituted amino acids are derived from AAVrh.10, where the amino acid substitutions allow detargeting from the liver, kidney, and / or spleen.
[000130] In some embodiments, the substituted amino acids are located in the VR-I region of the capsid. In some embodiments, the substituted amino acids are located on the surface of the capsid. In some embodiments, the substituted amino acids are located at the base of the protrusions on a triple axis of capsid symmetry. In some embodiments, the substituted amino acids are located in the depression on a double axis of symmetry of the capsid. In some embodiments, the substituted amino acids are located within the VR-II region of the capsid protein, within the DE loop. In some embodiments, the substituted amino acids are located within the capsid's beta E chain.
[000131] In particular modalities, a “selective” modification results in the insertion and / or replacement and / or deletion of less than about 20, 18, 15, 12, 10, 9, 8, 7, 6, 5, 4, 3 or 2 contiguous amino acids.
[000132] The modified capsid proteins and capsids of the disclosure may additionally comprise any other modification, currently known or identified later.
[000133] For example, AAV capsid proteins and virus capsids of the disclosure may be chimeric in that they may comprise all or a portion of a capsid subunit of another virus, optionally another parvovirus or another AAV serotype, for example example, as described in international patent publication No. WO 00/28004.
[000134] The virus capsid can comprise a sequence of
Petition 870190078272, of 8/13/2019, p. 221/335
47/120 targeting (for example, replaced and / or inserted into the viral capsid) that directs the virus capsid to interact with cell surface molecules present on one or more desired target tissues (see, for example, the international patent publication WO 00/28004 and Hauck et al. (2003) J. Virology 77: 2768-2774); Shi et al. Human Gene Therapy 17: 353-361 (2006) [describing the insertion of the RGD motif binding to the integrin receptor at positions 520 and / or 584 of the AVV capsid subunit]; US Patent No. 7,314,912 [describing the insertion of the P1 peptide containing an RGD motif after the amino acid positions 447, 534, 573 and 587 of the AAV2 capsid subunit] and international patent publication No. WO 2015038958 [describing recovery selection of AAV vectors containing peptide sequences showing increased central nervous system transduction]). Other positions within the AVV capsid subunit that tolerate insertions are known in the art (for example, positions 449 and 588 described by Grifman et al. Molecular Therapy 3: 964-975 (2001)).
[000135] For example, some of the virus capsids of the disclosure have relatively ineffective tropism towards the main target tissues of interest (for example, liver, skeletal muscle, heart, diaphragm muscle, kidney, brain, stomach, intestines, skin, cells endothelial, and / or lungs). A targeting sequence can advantageously be incorporated into these low transduction vectors to thereby give the virus capsid a desired tropism and, optionally, selective tropism for one or more particular tissues. AAV capsid proteins, capsids and vectors comprising targeting sequences are described, for example, in international patent publication WO 00/28004. As another possibility, one or more amino acids that do not occur naturally as described by Wang et al. (Annu Rev Biophys Biomol Struct.
Petition 870190078272, of 8/13/2019, p. 222/335
48/120
35: 225-49 (2006)) can be incorporated within the AVV capsid subunit at an orthogonal site as a means of redirecting a low transduction vector to one or more desired target tissues. These unnatural amino acids can be used advantageously to chemically link molecules of interest to the AAV capsid protein including without limitation: glycans (mannose - targeting dendritic cells); RGD, bombesin or a neuropeptide for targeted delivery to specific types of cancer cells; RNA aptamers or peptides selected from phage displays targeted to specific cell surface receptors such as growth factor receptors, integrins, and the like. Methods of chemically modifying amino acids are known in the art (see, for example, Greg T. Hermanson, Bioconjuqate Techniques, 1 ^st edition, Academic Press, 1996).
[000136] In representative embodiments, the targeting sequence can be a virus capsid sequence (e.g., autonomous parvovirus capsid sequence, AVV capsid sequence, or any other viral capsid sequence) that directs infection to one or more private cell types.
[000137] As another non-limiting example, a heparin-binding domain (for example, the heparin-binding domain of the respiratory syncytial virus) can be inserted or replaced within a capsid subunit that does not typically bind to sulfate receptors heparan (HS) (e.g., AAV 4, AAV5) in order to confer heparin binding to the resulting mutant.
[000138] As another non-limiting example, amino acid footprints that can allow binding to glycans such as galactose, sialic acid, mannose, lactose, sulfo-N-lactosamine, galactosamine, glucose, glucosamine, fructose, fucose, gangliosides, chitotriosis, chondroitin sulfate, keratin sulfate, dermatan sulfate can be found in
Petition 870190078272, of 8/13/2019, p. 223/335
49/120 xerted on a capsid subunit that does not typically bind to one or more of the sugars listed above [for example, US Patent Publication No. US20160017005, entitled Methods and compositions for dual glycan binding AAV vectors].
[000139] B19 infects primary erythroid progenitor cells using globoside as its receptor (Brown et al. (1993) Science 262: 114). The structure of B19 was determined up to a resolution of 8 Á (Agbandje-McKenna et al. (1994) Virology 203: 106). The region of the B19 capsid that binds to globoside was mapped between amino acids 399 to 406 (Chapman et al. (1993) Virology 194: 419), a region in loop between the structures of β-barrier E and F (Chipman et al (1996) Proc. Nat. Acad. Sci. USA 93: 7502). Therefore, the B19 capsid globoside receptor binding domain can be substituted within the AAV capsid protein to target a virus capsid or virus vector comprising the same to erythroid cells.
[000140] In representative embodiments, the exogenous targeting sequence can be any sequence of amino acids encoding a peptide that alters the tropism of a virus capsid or virus vector comprising the modified AAV capsid protein. In particular embodiments, the targeting peptide or protein may be naturally occurring or, alternatively, completely or partially synthetic. Examples of targeting sequences include ligands and other peptides that bind to cell surface receptors and glycoproteins, such as RGD peptide sequences, bradykinin, hormones, peptide growth factors (e.g., epidermal growth factor, nerve growth factor, fibroblast growth factor, platelet-derived growth factor, insulin-like growth factors I and II, etc.), cytokines, melanocyte stimulating hormone (e.g., α, β or γ), neuropeptides and endorphins, and the like,
Petition 870190078272, of 8/13/2019, p. 224/335
50/120 and fragments thereof that retain the ability to direct cells to their cognate receptors. Other illustrative peptides and proteins include substance P, keratinocyte growth factor, neuropeptide Y, gastrin-releasing peptide, interleukin 2, hen egg white lysozyme, erythropoietin, gonadoliberin, corticostatin, β-endorphin, leukoencephalin, rimorphin , α-neoencephalin, angiotensin, pneumadine, vasoactive intestinal peptide, neurotensin, motilin, and fragments thereof as described above. As yet a further alternative, the binding domain of a toxin (e.g., tetanus toxin or snake toxins, such as α-bungarotoxin, and the like) can be substituted within the capsid protein as a targeting sequence. In yet an additional representative embodiment, the AAV capsid protein can be modified by replacing an “nonclassical” import / export signal peptide (eg, fibroblast growth factor 1 and 2, interleukin 1, Tat protein from HIV-1, herpes virus VP22 protein, and the like) as described by Cleves (Current Biology 7: R318 (1997)) within the AAV capsid protein. Also included are peptide motifs that direct uptake by specific cells, for example, an FVFLP peptide motif triggers uptake by liver cells.
[000141] Phage display techniques, as well as other techniques known in the art, can be used to identify peptides that recognize any cell type of interest.
[000142] The targeting sequence can encode any peptide that directs to a cell surface binding site, including receptors (for example, protein, carbohydrate, glycoprotein or proteoglycan). Examples of cell surface binding sites include, but are not limited to, heparan sulfate, chondroitin sulfate, and other glycosaminoglycans, sialic acid moieties,
Petition 870190078272, of 8/13/2019, p. 225/335
51/120 portions of polyisalic acid, glycoproteins, and gangliosides, MHC I glycoproteins, carbohydrate components found on membrane glycoproteins, including, mannose, N-acetyl-galactosamine, Nacetyl-glucosamine, fucose, galactose, and the like.
[000143] As yet an additional alternative, the targeting sequence can be a peptide that can be used for chemical bonding (for example, it can comprise arginine and / or lysine residues that can be chemically linked through its R groups) to another molecule that directs entry into a cell.
[000144] The modifications described above can be incorporated within the capsid or capsid proteins of the disclosure in combination with each other and / or with any other modification currently known or discovered later.
[000145] The disclosure also encompasses virus vectors comprising the modified capsid proteins and capsids of the disclosure. In particular embodiments, the virus vector is a parvovirus vector (for example, comprising a parvovirus capsid and / or vector genome), for example, an AAV vector (for example, comprising an AVV capsule and / or genome of the vector). In representative embodiments, the virus vector comprises a modified AVV capsid comprising a modified capsid subunit of the disclosure and a genome of the vector.
[000146] For example, in representative embodiments, the virus vector comprises: (a) a modified virus capsid (for example, a modified AVV capsid) comprising a modified capsid protein of the disclosure; and (b) a nucleic acid comprising a terminal repeat sequence (e.g., an AAV TR), wherein the nucleic acid comprising the terminal repeat sequence is encapsulated by the modified virus capsid. The nucleic acid can optionally comprise two repeats
Petition 870190078272, of 8/13/2019, p. 226/335
52/120 terminal tions (for example, two AAV TRs).
[000147] In representative embodiments, the virus vector is a recombinant virus vector comprising a heterologous nucleic acid molecule encoding a functional protein or RNA of interest. Recombinant virus vectors are described in more detail below.
[000148] It will be understood by those skilled in the art that modified capsid proteins, virus capsids and virus vectors from disclosure exclude capsid proteins, capsids and virus vectors that have the amino acids indicated in the positions specified in their native state (ie yes, they are not mutants).
Virus Vector Production Methods
[000149] The present disclosure further provides methods of producing the virus vectors of the invention. In a representative embodiment, the present disclosure provides a method of producing a virus vector, the method comprising providing for a cell: (a) a nucleic acid model comprising at least one TR sequence (for example, a TR sequence AAV sequences), and (b) sufficient AAV sequences for replication of the nucleic acid model and encapsidation within AVV capsids (e.g., AAV rep sequences and AAV cap sequences encoding the AVV capsids of the present invention). Optionally, the nucleic acid model additionally comprises at least one heterologous nucleic acid sequence. In particular embodiments, the nucleic acid model comprises two AAV ITR sequences, which are located 5 'and 3' for the heterologous nucleic acid sequence (if present), although they need not be directly contiguous to it.
[000150] The nucleic acid model and the rep and cap sequences of the AAV are provided under conditions such that the virus vector with
Petition 870190078272, of 8/13/2019, p. 227/335
53/120 comprising the nucleic acid model packaged within the AVV capsid is produced in the cell. The method can further comprise the step of collecting the virus vector from the cell. The virus vector can be collected from the medium and / or by cell lysis.
[000151] The cell can be a cell that is permissive for replication of the viral AAV. Any suitable cell known in the art can be employed. In particular embodiments, the cell is a mammalian cell. As another option, the cell can be a trans-complementary packaging cell line that provides deleted functions of a defective helper virus for replication, for example, 293 cells or other trans-complementary E1a cells.
[000152] The replication and capsid AAV sequences can be provided by any method known in the art. Current protocols typically express the AAV rep / cap genes on a single plasmid. The replication and packaging AAV sequences do not need to be provided together, although it may be convenient to do so. AAV rep and / or cap sequences can be provided by any viral or non-viral vector. For example, rep / cap sequences can be provided by an adenovirus or herpesvirus hybrid vector (for example, inserted within the E1a or E3 regions of a deleted adenovirus vector). EBV vectors can also be used to express the AAV cap and rep genes. An advantage of this method is that EBV vectors are episomic, and will maintain a high number of copies across successive cell divisions (that is, they are stably integrated within the cell as extrachromosomal elements, referred to as a “nuclear-based episome” of EBV, ”see Margolski (1992) Curr. Top. Microbiol. Immun. 158: 67).
[000153] As an additional alternative, rep / cap sequences can be incorporated stably within a cell.
Petition 870190078272, of 8/13/2019, p. 228/335
54/120
[000154] Typically AAV rep / cap sequences will not be flanked by TRs, to prevent retrieval and / or packaging of these sequences.
[000155] The nucleic acid model can be provided to the cell using any method known in the art. For example, the model can be supplied by a non-viral (for example, plasmid) or viral vector. In particular embodiments, the nucleic acid model is supplied by a herpesvirus or adenovirus vector (for example, inserted within the E1a or E3 regions of a deleted adenovirus). As another illustration, Palombo et al. (1998) J. Virology 72: 5025, describe a baculovirus vector carrying a reporter gene flanked by AAV TRs. EBV vectors can also be used to release the model, as described above with respect to the rep / cap genes.
[000156] In another representative embodiment, the nucleic acid model is provided by a replicating rAAV virus. In still other embodiments, an AAV provirus comprising the nucleic acid model is stably integrated within the cell's chromosome.
[000157] To increase virus titers, helper virus functions (for example, adenovirus or herpesvirus) that promote productive AAV infection can be provided to the cell. Helper virus sequences necessary for AAV replication are known in the art. Typically, these sequences will be provided by an adenovirus or helper herpesvirus vector. Alternatively, the adenovirus or herpesvirus sequences can be provided by another non-viral or viral vector, for example, as a non-infectious adenovirus miniplasmid that carries all of the helper genes that promote effective AAV production as described by Ferrari et al., ( 1997) Nature Med. 3: 1295, and in US Patent Nos.
Petition 870190078272, of 8/13/2019, p. 229/335
55/120
6,040,183 and 6,093,570.
[000158] In addition, helper virus functions can be provided by a packaging cell with the helper sequences embedded in the chromosome or maintained as a stable extrachromosomal element. Helper virus sequences generally cannot be packaged into AAV virions, for example, they are not flanked by TRs.
[000159] Those skilled in the art will recognize that it may be advantageous to provide AAV replication and capsid sequences and helper virus sequences (for example, adenovirus sequences) over a single helper construct. This auxiliary construct can be a non-viral or viral construct. As a non-limiting illustration, the auxiliary construct can be a hybrid adenovirus or a hybrid herpesvirus comprising the AAV rep / cap genes.
[000160] In a particular embodiment, the AAV rep / cap sequences and the adenovirus helper sequences are supplied by a single adenovirus helper vector. This vector may additionally comprise the nucleic acid model. The rep / cap sequences of the AAV and / or the rAAV model can be inserted into a deleted region (for example, the E1a or E3 regions) of the adenovirus.
[000161] In an additional embodiment, the AAV rep / cap sequences and the adenovirus helper sequences are supplied by a single adenovirus helper vector. According to this modality, the rAAV model can be offered as a plasmid model.
[000162] In another illustrative embodiment, the AAV rep / cap sequences and the adenovirus helper sequences are provided by a single adenovirus helper vector, and the rAAV model is integrated within the cell as a provirus. Alternatively, the mo
Petition 870190078272, of 8/13/2019, p. 230/335
56/120 rAAV model is provided by an EBV vector that is kept inside the cell as an extrachromosomal element (for example, as an EBV-based nuclear episome).
[000163] In an additional example embodiment, the AAV rep / cap sequences and the adenovirus helper sequences are provided by a single adenovirus helper. The rAAV model can be provided as a separate replication viral vector. For example, the rAAV model can be provided by a rAAV particle or by a second recombinant adenovirus particle.
[000164] In accordance with the foregoing methods, the hybrid adenovirus vector typically comprises adenovirus 5 'and 3' cis sequences sufficient for adenovirus replication and packaging (i.e., adenovirus terminal repeats and PAC sequence). The rep / cap sequences of the AAV and, if present, the rAAV model are embedded in the adenovirus structure and are flanked by the 5 'and 3' cis sequences, so that these sequences can be packaged within the adenovirus capsids. As described above, helper adenovirus sequences and AAV rep / cap sequences are generally not flanked by TRs so that these sequences are not packaged within AAV virions.
[000165] Zhang et al. ((2001) Gene Ther. 18: 704-12) describe a chimeric helper comprising both adenovirus and the AAV rep and cap genes.
[000166] Herpes viruses can also be used as an auxiliary virus in AAV packaging methods. Hybrid herpes viruses encoding the AAV Rep protein (s) can advantageously facilitate scalable AAV vector production schemes. A vector of the hybrid herpes simplex virus type I (HSV-1) has been described expressing the rep and cap genes of AAV-2 (Conway et al. (1999) Gene Therapy 6: 986 eWO 00/17377.
Petition 870190078272, of 8/13/2019, p. 231/335
57/120
[000167] As an additional alternative, the virus vectors of the disclosure can be produced in insect cells using baculovirus vectors to release the rep / cap genes and rAAV model as described, for example, by Urabe et al. (2002) Human Gene Therapy 13: 1935-43.
[000168] Stocks of AAV vectors free of contaminating helper viruses can be obtained by any method known in the art. For example, AAV and helper virus can be readily differentiated based on size. AAV can also be separated from the helper virus based on affinity chromatography [for example, for a heparin substrate (Zolotukhin et al. (1999) Gene Therapy 6: 973) or using affinity resin (Wang et al., ( 2015), Mol Ther Methods Clin Dev 2: 15040) or, for example, by other methods (reviewed in Qu et al. (2015) Curr Pharm Biotechnol. 16 (8): 684-95)]. Deleted defective helper viruses for replication can be used so that any contaminating helper viruses are not competent for replication. As an additional alternative, an adenovirus helper may be employed lacking late gene expression, since only early gene expression of adenovirus is required to mediate the packaging of the AAV virus. Defective adenovirus mutants for late gene expression are known in the art (for example, adenovirus mutants tslOOK and ts149).
Recombinant Virus Vectors
[000169] The virus vectors of the present disclosure are useful for the release of nucleic acids to cells in vitro, ex vivo, and in vivo. In particular, virus vectors can be used advantageously to release or transfer nucleic acids to animal, including mammalian, cells.
[000170] Any one or more nucleic acid sequences he
Petition 870190078272, of 8/13/2019, p. 232/335
58/120 terologists of interest can be released into the virus vectors of this disclosure. The nucleic acids of interest include nucleic acids encoding polypeptides, including therapeutic proteins (for example, for medical or veterinary uses) or immunogenic proteins (for example, for vaccines) and / or functional or therapeutic RNA molecules.
[000171] Therapeutic polypeptides include, but are not limited to, cystic fibrosis transmembrane regulatory protein (CFTR), dystrophin (including mini- and micro-dystrophins, see, for example, Vincent et al. (1993) Nature Genetics 5: 130; US Patent Publication No. 2003/017131; International Patent Publication WO / 2008/088895, Wang et al. Proc. Natl. Acad. Sci. USA 97: 1371413719 (2000); and Gregorevic et al. Mol. Ther 16: 657-64 (2008)), myostatin propeptide, folistatin, soluble activin type II receptor, IGF1, anti-inflammatory polypeptides such as the dominant mutant Ikappa B, sarcospan, utrophin (Tinsley et al. (1996) Nature 384 : 349), mini-utrophin, clotting factors (eg, Factor VIII, Factor IX, Factor X, etc.), erythropoietin, angiostatin, endostatin, catalase, tyrosine hydroxylase, superoxide dismutase, leptin, the LDL receptor, lipoprotein lipase, ornithine transcarbamylase, β-globin, α-globin, spectrin, ai-antitrypsin, adenosine desami nase, hypoxanthine guanine phosphoribosyl transferase, β-glucocerebrosidase, sphingomyelinase, hexosaminidase A lysosomal, keto branched-chain acid dehydrogenase, RP65 protein, cytokines (for example, a-interferon, β-interferon, interferon-γ, interleukin-2, interleukin-2, interleukin-2, interleukin-2, interleukin-2, interleukin-2, 4, granulocyte macrophage colony stimulating factor, lymphotoxin, and the like), peptide growth factors, neurotrophic factors and hormones (eg, somatotropin, insulin, insulin-like growth factors 1 and 2, platelet-derived growth factor, epidermal growth factor, fibroblast growth factor, growth factor
Petition 870190078272, of 8/13/2019, p. 233/335
59/120 nervous, neurotrophic factor 3 and 4, brain-derived neurotrophic factor, bone morphogenic proteins [including RANKL and VEGF], derived glial growth factor, transforming growth factor α and β, and the like), α-glucosidase lysosomal acid , a-galactosidase A, receptors (eg, tumor necrosis growth factor a soluble receptor), S100A1, parvalbumin, adenylyl cyclase type 6, a molecule that modulates calcium handling (eg, SERCA2a, Inhibitor 1 of PP1 and fragments thereof (for example, WO 2006/029319 and WO 2007/100465)), a molecule that effects the knockout of type 2 receptor kinase coupled to G protein such as a constitutively truncated active bARKct, anti-inflammatory factors such as IRAP, anti-myostatin proteins, aspartoacylase, monoclonal antibodies (including single-chain monoclonal antibodies; an exemplary Mab is Mab Herceptin®), neuropeptides and fragments thereof (for example, galanine, Neuropeptide Y (see, U.S. Patent No. 7,071,172), angiogenesis inhibitors such as Vasohibins and other VEGF inhibitors (for example, Vasohibina 2 [see, WO JP2006 / 073052]). Other illustrative heterologous nucleic acid sequences encode suicide gene products (eg, thymidine kinase, cytosine deaminase, diphtheria toxin, and tumor necrosis factor), proteins conferring resistance to a drug used in cancer therapy, tumor suppressor genetic products (for example , p53, Rb, Wt-1), TRAIL, FAS ligand, and any other polypeptide that has a therapeutic effect on a subject who needs it. AAV vectors can also be used to release monoclonal antibodies and antibody fragments, for example, an antibody or antibody fragment directed against myostatin (see, for example, Fang et al. Nature Biotechnology 23: 584-590 (2005)) . [000172] Heterologous nucleic acid sequences encoding polypeptides include the sequences encoding polypeptides reset
Petition 870190078272, of 8/13/2019, p. 234/335
60/120 ter (for example, an enzyme). Reporter polypeptides are known in the art and include, but are not limited to, green fluorescent protein (GFP), β-galactosidase, alkaline phosphatase, luciferase, and the chloramphenicol acetyltransferase gene.
[000173] Optionally, the heterologous nucleic acid molecule can encode a secreted polypeptide (for example, a polypeptide that is a polypeptide secreted in its native state or that has been manipulated to be secreted, for example, by operable association with a sequence of secretory signal as is known in the art).
[000174] Alternatively, in particular embodiments of this disclosure, the heterologous nucleic acid can encode an antisense nucleic acid, a ribozyme (for example, as described in US Patent No. 5,877,022), RNAs that perform spliceosome-mediated trans-splicing ( see, Puttaraju et al. (1999) Nature Biotech. 17: 246; US Patent No. 6,013,487; US Patent No. 6,083,702), interfering RNAs (RNAi) including siRNA, shRNA or miRNA that mediate genetic silencing (see , Sharp et al. (2000) Science 287: 2431), and other untranslated RNAs, such as "guide" RNAs (Gorman et al. (1998) Proc. Nat. Acad. Sci. USA 95: 4929; US Patent No. 5,869,248 to Yuan et al.), And the like. Examples of untranslated RNAs include RNAi against a multi-drug resistance (MDR) gene product (for example, to treat and / or prevent tumors and / or for administration to the heart to prevent damage by chemotherapy), RNAi against myostatin (for example , for Duchenne muscular dystrophy), RNAi against VEGF (for example, to treat and / or prevent tumors), RNAi against frosfolamban (for example, to treat cardiovascular disease, see, for example, Andino et al. J. Gene Med 10: 132-142 (2008) and Li et al. Acta Pharmacol Sin. 26: 51-55 (2005)); phospholamban-inhibitory or dominant-negative molecules such as phospholam
Petition 870190078272, of 8/13/2019, p. 235/335
61/120 ban S16E (for example, to treat cardiovascular disease, see, for example, Hoshijima et al. Nat. Med. 8: 864-871 (2002)), RNAi for adenosine kinase (for example, for epilepsy), and RNAi directed against pathogenic organisms and viruses (for example, hepatitis B and / or C virus, human immunodeficiency virus, CMV, herpes simplex virus, human papilloma virus, etc.).
[000175] In addition, a nucleic acid sequence that targets alternative splicing can be released. In order to illustrate, an antisense sequence (or other inhibitory sequence) complementary to the 5 'and / or 3' splicing site of dystrophin exon 51 can be released in conjunction with a small nuclear sn (R) U1 or U7 promoter for induce skipping this exon. For example, a DNA sequence comprising a U1 or U7 snRNA promoter located 5 'to one or more antisense / inhibitory sequences can be packaged and released into a modified capsid of the disclosure.
[000176] The virus vector can also comprise a heterologous nucleic acid molecule that shares homology and recombines with a locus on a host chromosome. This approach can be used, for example, to correct a genetic defect in the host cell.
[000177] The present disclosure also provides virus vectors that express an immunogenic polypeptide, for example, for vaccination. The nucleic acid molecule can encode any immunogen of interest known in the art including, but not limited to, immunogens of human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), influenza virus, HIV gag proteins or SIV, tumor antigens, cancer antigens, bacterial antigens, viral antigens, and the like.
[000178] An immunogenic polypeptide can be any polypeptide suitable for eliciting an immune response and / or protecting its
Petition 870190078272, of 8/13/2019, p. 236/335
62/120 against an infection and / or disease, including, but not limited to, microbial, bacterial, protozoan, parasitic, fungal and / or viral infections and diseases. For example, the immunogenic polypeptide may be an orthomyxovirus immunogen (for example, an influenza virus immunogen, such as the influenza virus hemagglutinin (HA) surface protein or the influenza virus nucleoprotein, or an equine influenza virus immunogen) or a lentivirus immunogen (for example, an equine infectious anemia virus immunogen, a simian immunodeficiency virus (SIV) immunogen, or a human immunodeficiency virus (HIV) immunogen, such as the GP160 protein in the envelope envelope. HIV or SIV, the HIV / SIV matrix / capsid proteins, and the gag, pol and in / HIV or SIV gene products). The immunogenic polypeptide may also be an arenavirus immunogen (for example, the Lassa fever virus immunogen, such as the Lassa fever virus nucleocapsid protein and the Lassa fever envelope glycoprotein), a poxvirus immunogen (for example, a vaccinia virus immunogen, such as vaccinia L1 or L8 gene products), a flavivirus immunogen (for example, a yellow fever virus immunogen or a Japanese encephalitis virus immunogen), a filovirus immunogen (for example, an immunogen from the Ebola virus, or an immunogen from the Marburg virus, such as the NP and GP gene products), an immunogen from the bunyavirus (eg, immunogens from the RVFV, CCHF, and / or SFS viruses), or an coronavirus immunogen (for example, an infectious human coronavirus immunogen, such as the human coronavirus envelope glycoprotein, or a porcine transmissible gastroenteritis virus immunogen, or an infectious bronchitis virus immunogen avian iosa). The immunogenic polypeptide can also be a polio immunogen, a herpes immunogen (for example, CMV, EBV, HSV immunogens) an immunogen
Petition 870190078272, of 8/13/2019, p. 237/335
63/120 mumps, measles immunogen, rubella immunogen, diphtheria toxin or other diphtheria toxin, pertussis antigen, hepatitis immunogen (eg hepatitis A, hepatitis B, hepatitis C, etc.), and / or any other vaccine immunogen currently known in the art or subsequently identified as an immunogen.
[000179] Alternatively, the immunogenic polypeptide can be any tumor or cancer cell antigen. Optionally, the tumor or cancerous antigen is expressed on the surface of the cancer cell. Examples of cancerous or tumor cell antigens are described in S.A. Rosenberg (Immunity 10: 281 (1991)). Other illustrative cancer and tumor antigens include, but are not limited to: the BRCA1 gene product, the BRCA2 gene product, gp100, tyrosinase, GAGE-1/2, BAGE, RAGE, LAGE, NY-ESO1, CDK-4, β- catenin, MUM-1, Caspase-8, KIAA0205, HPVE, SART-1, PRAME, p15, melanoma tumor antigens (Kawakami et al. (1994) Proc. Natl. Acad. Sci. USA 91: 3515; Kawakami et al ., (1994) J. Exp. Med., 180: 347; Kawakami et al. (1994) Cancer Res. 54: 3124), MART-1, gp100 MAGE-1, MAGE-2, MAGE-3, CEA, TRP-1, TRP-2, P15, tyrosinase (Brichard et al. (1993) J. Exp. Med. 178: 489); the genetic product HER-2 / neu (US Pat. No. 4,968,603), CA 125, LK26, FB5 (endosialin), TAG 72, AFP, CA19-9, NSE, DU-PAN-2, CA50, SPan- 1, CA72-4, HCG, STN (sialyl Tn antigen), c-erbB-2 proteins, PSA, LCanAg, estrogenic receptor, milk fat globulin, tumor suppressor protein p53 (Levine (1993) Ann. Rev. Biochem. 62: 623); mucin antigens (International Patent Publication No. WO 90/05142); telomerases; nuclear matrix proteins; prostatic acid phosphatase; antigens of the papilloma virus; and / or antigens currently known or discovered later to be associated with the following cancers: melanoma, adenocarcinoma, thymoma, lymphoma
Petition 870190078272, of 8/13/2019, p. 238/335
64/120 (e.g., non-Hodgkin's lymphoma, Hodgkin's lymphoma), sarcoma, lung cancer, liver cancer, colon cancer, leukemia, uterine cancer, breast cancer, prostate cancer, ovarian cancer, cervical cancer, bladder cancer, kidney cancer, pancreatic cancer, brain cancer and any other cancer or malignancy currently known or later identified (see, for example, Rosenberg (1996) Ann. Rev. Med. 47: 481-91).
[000180] As an additional alternative, the heterologous nucleic acid can encode any polypeptide that is desirably produced in a cell in vitro, ex vivo, or in vivo. For example, virus vectors can be introduced into cultured cells and the expressed gene product isolated from them.
[000181] In additional embodiments, the heterologous nucleic acid can encode (a) a site-modifying polypeptide based on zinc finger nucleases or meganucleases or endonucleases or nucleases based on the TALENs or CRISPR / Cas system which contain a binding portion to RNA that interacts with an RNA molecule targeting DNA (gRNA), or an mRNA encoding the said polypeptide; (b) one or more guide RNA molecules (gRNAs) comprising a sequence of nucleotides that is complementary to a sequence in a target DNA, and a second segment that interacts with a modifier polypeptide directed to the site; and / or (c) one or more DNA donor model molecules comprising a single or double stranded DNA sequence designed for homologous recombination within the target site of a mammalian genome. For example, virus vectors can be introduced into stem cells and / or T lymphocytes ex vivo, cultured cells, tissues and / or whole organisms in vivo and the expressed gene product allows for editing, disruption, transcriptional activation and / or repression of target genes in the host.
Petition 870190078272, of 8/13/2019, p. 239/335
65/120
[000182] It will be understood by those skilled in the art that one or more heterologous nucleic acid molecules of interest can be operationally associated with appropriate control sequences. For example, the heterologous nucleic acid molecule can be operationally associated with expression control elements, such as transcription / translation control signals, origins of replication, polyadenylation signals, internal ribosome entry sites (IRES), promoters, and / or reinforcers, and the like.
[000183] In addition, regulated expression of one or more heterologous nucleic acid molecules of interest can be obtained at the post-transcriptional level, for example, by regulating the selective splice of different introns by the presence or absence of an oligonucleotide, small molecule and / or another compound that selectively blocks splicing activity at specific sites (for example, as described in WO 2006/119137).
[000184] Those skilled in the art will recognize that a variety of promoter / reinforcer elements can be used depending on the level and specific tissue expression desired. The promoter / enhancer can be constitutive or inducible, depending on the desired expression pattern. The promoter / enhancer can be native or foreign and can be a natural sequence or a synthetic sequence. Strangely, it is indicated that the transcriptional initiation region is not found in the wild host into which the transcriptional initiation region is introduced.
[000185] In particular modalities, the promoter / reinforcer elements can be native to the target cell or to the subject to be treated. In representative embodiments, the promoter / enhancer element can be native to the heterologous nucleic acid sequence. The promoter / reinforcer element is usually chosen so that it functions in the target cell (s) of interest. Furthermore, in
Petition 870190078272, of 8/13/2019, p. 240/335
In particular, the reinforcing promoter element I can be a mammalian promoting / reinforcing element. The promoter / reinforcer element can be constitutive or inducible.
[000186] Inducible expression control elements are typically advantageous in applications in which it is desirable to provide regulation over the expression of the heterologous nucleic acid sequence (s). Inducible promoter / booster elements for genetic release may be tissue-specific or preferential promoter / booster elements, and include specific or preferred muscle / promoter / booster elements (including specific or preferred for cardiac, skeletal and / or smooth muscles), specific or preferred for neural tissue (including specific or preferred for the brain), specific or preferred for the eyes (including specific for the retina and specific for the cornea), specific or preferred for the liver, specific or preferred for the bone marrow, specific or preferential for the pancreas, specific or preferential for the spleen, and specific or preferential for the lungs. Other inducible promoter / reinforcer elements include hormone-inducible and metal-inducible elements. Examples of inducible promoter / enhancer elements include, but are not limited to, a Tet on / off element, an RU486-inducible promoter, an ecdysone-inducible promoter, a rapamycin-inducible promoter, and a metallothionein-inducible promoter.
[000187] In embodiments in which the heterologous nucleic acid sequence (s) is transcribed and then translated into target cells, specific initiation signals are generally included for effective translation of coding sequences from inserted proteins. These exogenous translational control sequences, which may include the ATG initiation codon and adjacent sequences, can be of
Petition 870190078272, of 8/13/2019, p. 241/335
67/120 a variety of origins, both natural and synthetic.
[000188] The virus vectors according to the present disclosure provide a means for the release of heterologous nucleic acids within a wide range of cells, including dividing and non-dividing cells. Virus vectors can be used to release a nucleic acid of interest to a cell in vitro, for example, to produce a polypeptide in vitro or for ex vivo gene therapy. Virus vectors are additionally useful in a method of releasing a nucleic acid to a subject who needs it, for example, to express an immunogenic or therapeutic polypeptide or functional RNA. In this way, the polypeptide or functional RNA can be produced in vivo in the subject. The subject may be in need of the polypeptide because the subject has a deficiency of the polypeptide. In addition, the method can be practiced because the production of the polypeptide or functional RNA in the subject may confer some beneficial effect.
[000189] Virus vectors can also be used to produce a polypeptide of interest or functional RNA in cultured cells or in a subject (for example, using the subject as a bioreactor to produce the polypeptide or to observe the effects of functional RNA on the subject, for example, in connection with screening methods).
[000190] In general, the virus vectors of the present disclosure can be employed to release a heterologous nucleic acid encoding a functional polypeptide or RNA to treat and / or prevent any disease state for which it is beneficial to release a therapeutic polypeptide or functional RNA . Illustrative disease states include, but are not limited to: cystic fibrosis (transmembrane regulatory protein for cystic fibrosis) and other lung diseases, hemophilia A (Factor VIII), hemophilia B (Factor IX), thalassemia (β-globin), ane
Petition 870190078272, of 8/13/2019, p. 242/335
68/120 mia (erythropoietin) and other blood disorders, Alzheimer's disease (GDF; neprilisine), multiple sclerosis (β-interferon), Parkinson's disease (neurotrophic factor derived from glial cell line [GDNF]), Huntington (RNAi to remove repetitions), amyotrophic lateral sclerosis, epilepsy (galanin, neurotrophic factors), and other neurological disorders, cancer (endostatin, angiostatin, TRAIL, FAS ligand, cytokines including interferons; RNAi including RNAi against VEGF or the genetic product of multiple drug resistance, mir-26a [for example, for hepatocellular carcinoma]), diabetes mellitus (insulin), muscular dystrophies including Duchenne's dystrophy (dystrophin, mini-dystrophin, insulin-like growth factor I, a sarcoglycan [ for example, α, β, γ], RNAi against myostatin, myostatin propeptide, follistatin, soluble activin type II receptor, anti-inflammatory polypeptides such as the dominant mutant Ikappa B, sarcos pan, utrofin, mini-utrofin, antisense or RNAi against splice junctions in the dystrophin gene to induce skipping exons [see, for example, WO / 2003/095647], antisense against U7 snRNAs to induce skipping exons [see, for example, WO / 2006/021724], and antibodies or fragments of antibodies against myostatin or myostatin propeptide) and Becker, Gaucher disease (glucocerebrosidase), Hurler's disease (α-L-iduronidase), adenosine deaminase (adenosine deaminase) deficiency, diseases glycogen storage (eg, Fabry's disease [α-galactosidase] and Pompe's disease [lysosomal acid α-glucosidase]) and other metabolic disorders, congenital emphysema (a1-antitrypsin), Lesch-Nyhan syndrome (phosphoribosyl guanine hypoxanthine) transferase), Niemann-Pick disease (sphingomyelinase), Tay Sachs disease (lysosomal hexosaminidase A), maple syrup urine disease (keto branched-chain acid dehydrogenase), degenerative retinal diseases (and other eye diseases the and the retina; for example, PDGF for macular degeneration
Petition 870190078272, of 8/13/2019, p. 243/335
69/120 and / or vasohibin or other VEGF inhibitors or other angiogenesis inhibitors to treat / prevent retinal disorders, for example, in Type I diabetes), diseases of solid organs such as the brain (including Parkinson's Disease [GDNF ], astrocytomas [endostatin, angiostatin and / or RNAi against VEGF], glioblastomas [endostatin, angiostatin and / or RNAi against VEGF]), liver, kidney, heart including congestive heart failure or peripheral arterial disease (PAD) (for example, by release of protein phosphatase I inhibitor (1-1) and fragments thereof (eg 11C), serca2a, zinc finger proteins that regulate the phospholamban gene, Barkct, p2-adrenergic receptor, p2-adrenergic kinase receptor (BARK ), phosphoinositide-3 kinase (kinase PI3), S100A1, parvalbumin, adenylyl cyclase type 6, a molecule that effects protein G coupled to the type 2 receptor kinase such as a constitutively active truncated bARKct; calsarcine, RNAi against phospholamban; phospholamban inhibitory or dominant-negative cells such as phospholamban S16E, etc.), arthritis (insulin-like growth factors), joint disorders (insulin-like growth factor 1 and / or 2), intimal hyperplasia (for example, by enos release, inos), improved survival in heart transplants (superoxide dismutase), AIDS (soluble CD4), loss of muscle mass (insulin-like growth factor I), renal failure (erythropoietin), anemia (erythropoietin) , arthritis (anti-inflammatory factors such as soluble IRAP and TNFα receptor), hepatitis (α-interferon), LDL receptor deficiency (LDL receptor), hyperammonemia (ornithine transcarbamylase), Krabbe disease (galactocerebrosidase), muscle atrophy spinal (SMA), Batten's disease, spinal cerebral ataxias including Friedreich's ataxia, SCA1, SCA2 and SCA3, phenylketonuria (phenylalanine hydroxylase), autoimmune diseases, and the like. The present invention can be further used after organ transplantation to increase the success of the
Petition 870190078272, of 8/13/2019, p. 244/335
70/120 transplant and / or to reduce the negative side effects of organ transplantation or adjunct therapies (for example, by administering immunosuppressive agents or inhibitory nucleic acids to block cytokine production). As another example, bone morphogenic proteins (including BMP 2, 7, etc., RANKL and / or VEGF) can be administered with a bone allograft, for example, after a rupture or surgical removal in a cancer patient. [000191] The present invention can also be used to produce induced pluripotent stem cells (iPS). For example, a virus vector of the disclosure can be used to release one or more nucleic acids associated with stem cells into a non-pluripotent cell, such as adult fibroblasts, skin cells, liver cells, kidney cells, fat cells , cardiac cells, neural cells, epithelial cells, endothelial cells, and the like. Nucleic acids encoding factors associated with stem cells are known in the art. Non-limiting examples of similar factors associated with stem cells and pluripotency include Oct-3/4, the SOX family (for example, SOX1, SOX2, SOX3 and / or SOX15), the Klf family (for example, Klf 1, Klf2, Klf4 and / or Klf5), the Myc family (for example, Cmyc, L-myc and / or N-myc), NANOG and / or LIN28.
[000192] The present invention can also be practiced to treat and / or prevent epilepsy, stroke, traumatic brain injury, cognitive disorders, behavioral disorders, psychiatric disorders, Huntington's disease, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), as well as any other neurodegenerative condition that may benefit from or require axonal / neuronal regeneration or repair.
[000193] In particular modalities, the present disclosure can be practiced to promote axonal regeneration and neuronal repair, restore circuits and / or replace lost neurons as a therapy
Petition 870190078272, of 8/13/2019, p. 245/335
71/120 brokerage house, for example, by targeted regulation or overexpression of stem cells, differentiation and reprogramming factors such as FoxJ1, Fox2, NeuroD2, NG2 or Olig2 and / or microRNAs such as miR137, MIRR124, as well as any other factors or miRNAs involved in neuronal development and differentiation.
[000194] Gene transfer has substantial potential utility for understanding and providing therapy for disease states. There are a number of inherited diseases in which defective genes are known and have been cloned. In general, the disease states above fall into two classes: deficiency states, usually enzymes, which are generally inherited in a recessive manner, and unbalanced states, which may involve regulatory or structural proteins, and which are typically hereditary in a dominant manner. For disease-deficient states, gene transfer can be used to bring a normal gene into affected tissues for replacement therapy, as well as to create animal models for the disease using antisense mutations. For unbalanced disease states, gene transfer can be used to create a disease state in a model system, which can then be used in efforts to neutralize the disease state. Therefore, the virus vectors according to the present disclosure allow the treatment and / or prevention of genetic diseases.
[000195] The virus vectors according to the present disclosure can also be employed to provide a functional RNA for a cell in vitro or in vivo. The expression of functional RNA in the cell, for example, can decrease the expression of a particular target protein by the cell. Therefore, functional RNA can be administered to decrease the expression of a particular protein in a subject who needs it. Functional RNA can also
Petition 870190078272, of 8/13/2019, p. 246/335
72/120 to be administered to cells in vitro to regulate gene expression and / or cell physiology, for example, to optimize cell or tissue culture systems or in screening methods.
[000196] In addition, the virus vectors according to the present invention find use in diagnostic and screening methods, by means of which a nucleic acid of interest is expressed transiently or stably in a cell culture system , or alternatively, a transgenic animal model.
[000197] The virus vectors of the present disclosure can also be used for a number of non-therapeutic purposes, including but not limited to use in protocols to assess genetic targeting, clearance, transcription, translation, etc., as would be evident to one skilled in the art. technical. Virus vectors can also be used for the purpose of assessing safety (spread, toxicity, immunogenicity, etc.). The data referred to, for example, are considered by the American agency FDA (United States Food and Drug Administration) as part of the regulatory approval process before assessing clinical effectiveness.
[000198] As an additional aspect, the virus vectors of the present disclosure can be used to produce an immune response in a subject. According to this embodiment, a virus vector comprising a heterologous nucleic acid sequence encoding an immunogenic polypeptide can be administered to a subject, and an active immune response is mounted by the subject against the immunogenic polypeptide. Immunogenic polypeptides are as described above. In some modalities, a protective immune response is elicited.
[000199] Alternatively, the virus vector can be administered to an ex vivo cell and the altered cell is administered to the subject. The virus vector comprising the heterologous nucleic acid is introduced
Petition 870190078272, of 8/13/2019, p. 247/335
73/120 within the cell, and the cell is administered to the subject, where the heterologous nucleic acid encoding the immunogen can be expressed and induce an immune response in the subject against the immunogen. In particular embodiments, the cell is an antigen-presenting cell (for example, a dendritic cell).
[000200] An "active immune response" or "active immunity" is characterized by "participation of host tissues and cells after an encounter with the immunogen. It involves differentiation and proliferation of immunocompetent cells in lymph reticular tissues, which lead to antibody synthesis or the development of cell-mediated reactivity, or both. ” Herbert B. Herscowitz, Immunophysiology: Cell Function and Cellular Interactions in Antibody Formation, in IMMUNOLOGY: BASIC PROCESSES 117 (Joseph A. Bellanti ed., 1985). In other words, an active immune response is assembled by the host after exposure to an immunogen by infection or vaccination. Active immunity can be contrasted with passive immunity, which is acquired by "transferring preformed substances (antibody, transfer factor, thymic graft, interleukin-2) from an actively immunized host to a non-immune host." Id.
[000201] A "protective" immune response or "protective" immunity as used here, in this patent application, indicates that the immune response confers some benefit to the subject by the fact that it prevents or reduces the incidence of disease. Alternatively, a protective immune response or protective immunity may be useful in treating and / or preventing disease, in particular cancer or tumors (for example, by preventing cancer or tumor formation, causing a cancer or tumor to regress and / or preventing metastasis and / or preventing the growth of metastatic nodules). The protective effects can be complete or partial, as long as the benefits of the
Petition 870190078272, of 8/13/2019, p. 248/335
74/120 treatment outweigh any disadvantages of it.
[000202] In particular embodiments, the virus or cell vector comprising the heterologous nucleic acid can be administered in an immunogenically effective amount, as described below.
[000203] The virus vectors of the present disclosure can also be administered for cancer immunotherapy by administering a virus vector expressing one or more cancer cell antigens (or an immunologically similar molecule) or any other immunogen that produces an immune response against a cancer cell. To illustrate, an immune response against a cancer cell antigen can be produced in a subject by administering a virus vector comprising a heterologous nucleic acid encoding the cancer cell antigen, for example to treat a cancer patient and / or to prevent cancer develops in the subject. The virus vector can be administered to a subject in vivo or using ex vivo methods, as described here, in this patent application. Alternatively, the carcinogenic antigen can be expressed with part of the virus capsid or can be associated differently with the virus capsid (for example, as described above).
[000204] As another alternative, any other therapeutic nucleic acid (for example, RNAi) or polypeptide (for example, cytokine) known in the art may be administered to treat and / or prevent cancer.
[000205] As used here, in this patent application, the term "cancer" encompasses tumor-forming cancers. Likewise, the term "cancerous tissue" includes tumors. A "cancer cell antigen" encompasses tumor antigens.
[000206] The term "cancer" has its meaning understood in the technique, for example, an uncontrolled growth of tissue that has the potential to spread to sites far from the body (ie, metastati
Petition 870190078272, of 8/13/2019, p. 249/335
75/120 zar). Examples of cancers include, but are not limited to, melanoma, adenocarcinoma, thymoma, lymphoma (e.g., non-Hodgkin's lymphoma, Hodgkin's lymphoma), sarcoma, lung cancer, liver cancer, colon cancer, leukemia, uterine cancer, cancer bladder cancer, prostate cancer, ovarian cancer, cervical cancer, bladder cancer, kidney cancer, pancreatic cancer, brain cancer and any other cancer or malignancy currently known or later identified. In representative embodiments, the present invention provides a method of treating and / or preventing tumor-forming cancers.
[000207] The term "tumor" is also understood in the art, for example, as an abnormal mass of undifferentiated cells within a multicellular organism. Tumors can be malignant or benign. In representative embodiments, the methods disclosed herein, in this patent application, are used to prevent and treat malignant tumors.
[000208] By the terms "treat cancer," "cancer treatment" and equivalent terms if it is intended that the severity of the cancer is reduced or at least partially eliminated and / or the progression of the disease is slowed and / or controlled and / or the disease is stabilized. In particular modalities, these terms indicate that cancer metastasis is prevented or reduced or at least partially eliminated and / or that the growth of metastatic nodules is prevented or reduced or at least partially eliminated.
[000209] By the terms "cancer prevention" or "prevent cancer" and equivalent terms it is intended that the methods at least partially eliminate or reduce and / or postpone the incidence and / or severity of the onset of cancer. Put another way, the onset of cancer the subject can be reduced in possibility or probability and / or delayed. [000210] In particular modalities, cells can be rowing
Petition 870190078272, of 8/13/2019, p. 250/335
76/120 lives of a subject with cancer and brought into contact with a virus vector expressing a cancer cell antigen according to the present invention. The modified cell is then administered to the subject, whereby an immune response against the cancer cell antigen is elicited. This method can be used advantageously with immunocompromised subjects who cannot mount a sufficient immune response in vivo (i.e., cannot produce an increase in antibodies in sufficient quantities).
[000211] It is known in the art that immune responses can be enhanced by immunomodulatory cytokines (for example, a-interferon, β-interferon, γ-interferon, ω-interferon, τ-interferon, interleukin-1a, interleukin-1 β, interleukin-2, interleukin-3, interleukin-4, interleukin 5, interleukin-6, interleukin-7, interleukin-8, interleukin-9, interleukin-10, interleukin-11, interleukin 12, interleukin-13, interleukin14, interleukin-14, interleukin-14 18, B cell growth factor, CD40 ligand, tumor necrosis factor -α, tumor necrosis factor -β, monocyte chemo-attracting protein -1, granulocyte macrophage colony stimulating factor, and lymphotoxin). Therefore, immunomodulatory cytokines (preferably CTL-inducing cytokines) can be administered to a subject in conjunction with the virus vector.
[000212] Cytokines can be administered by any method known in the art. Exogenous cytokines can be administered to the subject, or alternatively, a nucleic acid encoding a cytokine can be released to the subject using a suitable vector, and the cytokine produced in vivo.
Subjects, Pharmaceutical Formulations, and Modes of Administration [000213] Virus and capsid vectors according to the present disclosure find use in both veterinary and medical applications. Suitable subjects include both aviaries and mammals.
Petition 870190078272, of 8/13/2019, p. 251/335
77/120
The term "poultry" as used herein, in this patent application, includes, but is not limited to, chickens, ducks, geese, quail, turkeys, pheasant, parrots, parakeets, and the like. The term "mammals" as used herein, in this patent application, includes, but is not limited to, humans, non-human primates, cattle, sheep, goats, horses, felines, canines, lagomorphs, etc. Human subjects include neonatal, infant, juvenile, adult and geriatric individuals.
[000214] In representative modalities, the subject needs ”the methods of dissemination.
[000215] In particular embodiments, the present disclosure provides a pharmaceutical composition comprising a virus vector and / or capsid of the disclosure in a pharmaceutically acceptable carrier and, optionally, other medicinal agents, pharmaceutical agents, stabilizing agents, buffers, vehicles, adjuvants, thinners, etc. For injection, the vehicle will typically be a liquid. For other methods of administration, the vehicle can be either solid or liquid. For administration by inhalation, the vehicle will be breathable, and can optionally be in the form of solid or liquid particulate.
[000216] By "pharmaceutically acceptable" is meant a material that is not otherwise harmful or undesirable, that is, the material can be administered to a subject without causing any undesirable biological effects.
[000217] One aspect of the present disclosure is a method of transferring a nucleic acid to a cell in vitro. The virus vector can be introduced into the cells at the appropriate multiplicity of infection according to routine transduction methods suitable for the particular target cells. The titers of the virus vector to be administered can vary, depending on the type and number of target cells, and the virus vector in particular, and can be determined by those skilled in the art without undue experimentation. In modalities
Petition 870190078272, of 8/13/2019, p. 252/335
78/120 representative, at least about 10 ³ infectious units, optionally at least about 10 ⁵ infectious units are introduced into the cell
[000218] The one or more cells into which the virus vector is introduced can be of any type, including but not limited to neural cells (including cells from the peripheral and central nervous systems, in particular brain cells such as neurons and oligodendrocytes) , lung cells, eye cells (including retinal cells, retinal pigment epithelium, and corneal cells), epithelial cells (for example, intestinal and respiratory epithelial cells), muscle cells (for example, skeletal muscle cells, muscle cells cardiac cells, smooth muscle cells and / or diaphragm muscle cells), dendritic cells, pancreatic cells (including islet cells), liver cells, myocardial cells, bone cells (for example, bone marrow stem cells), stem cells hematopoietic, spleen cells, keratinocytes, fibroblasts, endothelial cells, prostate cells, germ cells, and the like. In representative embodiments, the cell can be any parent cell. As an additional possibility, the cell can be a stem cell (for example, a neural stem cell, a liver stem cell). As yet an additional alternative, the cell can be a cancer or tumor cell. In addition, the cell can be of any species of origin, as indicated above.
[000219] The virus vector can be introduced into cells in vitro for the purpose of administering the modified cell to a subject. In particular embodiments, the cells have been removed from a subject, the virus vector is introduced into it, and the cells are then administered back to the subject. Methods of removing cells from a subject for ex vivo manipulation, followed by introduction back into the subject are known in the art (see, for example, the patent
Petition 870190078272, of 8/13/2019, p. 253/335
79/120
No. 5,399,346). Alternatively, the recombinant virus vector can be introduced into the cells of a donor subject, into cultured cells, or into cells of any other suitable source, and the cells are administered to a subject who needs the same (that is, a receiving subject).
[000220] Cells suitable for ex vivo nucleic acid release are as described above. The dosages of the cells to be administered to a subject will vary depending on the age, condition and species of the subject, the type of cell, the nucleic acid being expressed by the cell, the mode of administration, and the like. Typically, at least about 10 ² to about 10 ⁸ cells or at least about 10 ³ to about 10 ⁶ cells will be administered per dose in a pharmaceutically acceptable carrier. In particular embodiments, cells transduced with the virus vector are administered to the subject in an amount effective for treatment or effective for prevention in combination with a pharmaceutical carrier.
[000221] In some embodiments, the virus vector is introduced into a cell and the cell can be administered to a subject to elicit an immunogenic response against the released polypeptide (for example, expressed as a transgene or in the capsid). Typically, an amount of cells is administered expressing an immunogenically effective amount of the polypeptide in combination with a pharmaceutically acceptable carrier. An "immunogenically effective amount" is an amount of the expressed polypeptide that is sufficient to elicit an active immune response against the polypeptide in the subject to whom the pharmaceutical formulation is administered. In particular modalities, the dosage is sufficient to produce a protective immune response (as defined above). The degree of protection conferred need not be complete or permanent, as long as the benefits of administering the immunogenic polypeptide outweigh the
Petition 870190078272, of 8/13/2019, p. 254/335
80/120 remove any disadvantages thereof.
[000222] An additional aspect of the disclosure is a method of administering the virus vector and / or virus capsid to the subjects. The administration of the virus and / or capsid vectors according to the present disclosure to a human subject or an animal in need thereof can be by any means known in the art. Optionally, the virus and / or capsid vector is released in an effective dose for treatment or effective for prevention in a pharmaceutically acceptable carrier.
[000223] The virus and / or capsid vectors of the disclosure can be additionally administered to elicit an immunogenic response (for example, as a vaccine). Typically, the immunogenic compositions of the present disclosure comprise an immunogenically effective amount of virus vector and / or capsid in combination with a pharmaceutically acceptable carrier. Optionally, the dosage is sufficient to produce a protective immune response (as defined above). The degree of protection provided need not be complete or permanent, as long as the benefits of administering the immunogenic polypeptide outweigh any disadvantages. Subjects and immunogens are as described above.
[000224] The dosages of the virus and / or capsid vector to be administered to a subject depend on the mode of administration, the disease or condition to be treated and / or prevented, the condition of the individual subject, the vector of the virus or capsid in particular, and the nucleic acid to be released, and the like, and can be determined in a routine manner. Examples of doses to achieve therapeutic effects are titers of at least about 10 ⁵ , 10 ⁶ , 10 ⁷ , 10 ⁸ , 10 ⁹ , 10 ¹⁰ , 10 ¹¹ , 10 ¹² , 10 ¹³ , 10 ¹⁴ , 10 ¹⁵ transduction units, optionally about 10 ⁸ to 10 ¹³ transduction units.
[000225] In particular modalities, more than one can be employed
Petition 870190078272, of 8/13/2019, p. 255/335
81/120 one administration (for example, two, three, four or more administrations) to achieve the desired level of gene expression over a period of several intervals, for example, daily, weekly, monthly, annually, etc.
[000226] Examples of modes of administration include oral, rectal, transmucosal, intranasal, inhalation (for example, by means of an aerosol), buccal (for example, sublingual), vaginal, intrathecal, intraocular, transdermal, in utero (or in egg), parenteral (for example, intravenous, subcutaneous, intradermal, intramuscular, intradermal, intrapleural, intracerebral, and intraarticular), topical (for example, on both mucosal and skin surfaces, including airway surfaces, and transdermal administration ), intralymphatic, and the like, as well as direct injection into tissue or organ (for example, into the liver, skeletal muscle, heart muscle, diaphragm muscle or brain). In some modalities, intramuscular includes administration to the skeletal muscle, diaphragm and / or cardiac. Administration can also be in a tumor (for example, in or near a tumor or a lymph node). The most appropriate route in any given case will depend on the nature and severity of the condition being treated and / or prevented and the nature of the particular vector being used.
[000227] Release to a target tissue can also be performed by releasing a deposit comprising the virus and / or capsid vector. In representative embodiments, a deposit comprising the virus and / or capsid vector is implanted within the skeletal, cardiac and / or diaphragm muscle tissue, or the tissue may be brought into contact with a film or other matrix comprising the virus vector and / or capsid. The referred implantable matrices or substrates are described in U.S. Patent No. 7,201,898.
[000228] In particular modalities, a virus vector and / or capsid
Petition 870190078272, of 8/13/2019, p. 256/335
82/120 virus deo according to the present disclosure is administered to skeletal muscle, diaphragm muscle and / or cardiac muscle (for example, to treat and / or prevent muscular dystrophy, heart disease). In some embodiments, a virus vector and / or virus capsid according to the present disclosure is administered to treat PAD or congestive heart failure.
[000229] Disclosure methods can also be practiced to produce antisense RNA, RNAi or other functional RNA (for example, a ribozyme) for systemic release
[000230] Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solutions or suspensions in liquid before injection, or with emulsions. Alternatively, the virus vector and / or virus capsids of the disclosure can be administered in one location instead of being administered systemically, for example, in a depot or in a gradual release formulation. In addition, the virus vector and / or virus capsid can be released adhered to a surgically implantable matrix (for example, as described in U.S. Patent Application Publication No. US-2004-0013645-A1).
[000231] Virus vectors and virus capsids can be administered to tissues of the cerebral nervous system (eg, brain, eyes) and may advantageously result in a wider distribution of the virus vector or capsids than would be observed in the absence of this disclosure.
[000232] In particular modalities, the release vectors of the disclosure can be administered to treat diseases of the central nervous system, including genetic disorders, neurodegenerative disorders, psychiatric disorders and tumors.
[000233] Illustrative diseases of the central nervous system include, but are not limited to, Alzheimer's disease, Parkinson's disease,
Petition 870190078272, of 8/13/2019, p. 257/335
83/120 Huntington's disease, Canavan's disease, Leigh's disease, Refsum's disease, Tourette's syndrome, primary lateral sclerosis, amyotrophic lateral sclerosis (ALS), progressive muscular atrophy, Pick's disease, muscular dystrophy, multiple sclerosis, myasthenia gravis , Binswanger's disease, trauma due to head and / or spinal cord injury (eg, traumatic brain injury), Tay Sachs disease, Lesch-Nyan disease, epilepsy, stroke, brain strokes, psychiatric disorders including mood disorders (e.g., depression, bipolar affective disorder, persistent affective disorder, secondary mood disorder), schizophrenia, drug addiction (e.g., alcoholism and addiction to other substances), neuroses (e.g., anxiety, obsessive disorder, somatoform disorder, dissociative disorder, grief, postpartum depression), psychosis (eg, hallucinations and delusions), dementia, paranoia, attention deficit disorder, p physico-sexual, any neurodegenerative condition that may benefit from or require axonal / neuronal regeneration and / or repair, cognitive disorders, behavioral disorders, sleep disorders, pain disorders, eating or weight disorders (eg, obesity, cachexia , anorexia nervosa, and bulimia) and cancers and tumors (eg, pituitary tumors) of the central nervous system.
[000234] Central nervous system disorders include ophthalmic disorders involving the retina, the posterior tract, and the optic nerve (eg, retinitis pigmentosa, diabetic retinopathy and other degenerative diseases of the retina, uveitis, age-related macular degeneration, glaucoma) .
[000235] Most, if not all, diseases and ophthalmic disorders are associated with one or more of three types of indications: (1) angiogenesis, (2) inflammation, and (3) degeneration. The release vectors for this disclosure can be used to release
Petition 870190078272, of 8/13/2019, p. 258/335
84/120 anti-angiogenic factors; anti-inflammatory factors; factors that slow down cell degeneration, promote cell economics, or promote cell growth and combinations of precedents.
[000236] Diabetic retinopathy, for example, is characterized by angiogenesis. Diabetic retinopathy can be treated by releasing one or more anti-angiogenic factors either intraocularly (for example, in the vitreous) or periocularly (for example, in the subTenon region). One or more neurotrophic factors can also be released concomitantly, either intraocularly (for example, intravitreally) or periocularly.
[000237] Uveitis involves inflammation. One or more anti-inflammatory factors can be administered by intraocular administration (eg, vitreous or anterior chamber) of a release vector of the disclosure.
[000238] Retinitis pigmentosa, in comparison, is characterized by degeneration of the retina. In representative embodiments, retinitis pigmentosa can be treated by intraocular administration (e.g., vitreous administration) of a release vector encoding one or more neurotrophic factors.
[000239] Age-related macular degeneration involves both angiogenesis and retinal degeneration. This disorder can be treated by administering the release vectors of the invention encoding one or more neurotrophic factors via the intraocular route (for example, in the vitreous) and / or one or more antiangiogenic factors via the intraocular route or via the periocular route (for example, in the region sub-Tenon).
[000240] Glaucoma is characterized by increased eye pressure and loss of retinal ganglion cells. Treatments for glaucoma include administering one or more neuroprotective agents that protect cells against excitotoxic damage using the release vectors of the invention. The agents referred to include antagonists
Petition 870190078272, of 8/13/2019, p. 259/335
85/120 of N-methyl-D-aspartate (NMDA), cytokines, and neurotrophic factors, released intraocularly, optionally intravitreally.
[000241] In other embodiments, the present disclosure can be used to treat seizures, for example, to reduce the onset, incidence or severity of seizures. The effectiveness of a therapeutic treatment for seizures can be assessed by behavioral (for example, twitching, twitching of the eye or mouth) and / or electrographic (most seizures have signature electrographic abnormalities). Therefore, the present invention can also be used to treat epilepsy, which is marked by multiple seizures over time.
[000242] In a representative modality, somatostatin (or an active fragment thereof) is administered to the brain using a release vector from the disclosure to treat a pituitary tumor. According to this modality, the libation vector encoding somatostatin (or an active fragment thereof) is administered by micro-infusion into the pituitary. Likewise, the referred treatment can be used to treat acromegaly (abnormal growth hormone secretion from the pituitary). The nucleic acid (for example, GenBank Access No. J00306) and amino acid (for example, GenBank Access No. P01166; sequences containing the somatostatin-28 and somatostatin-14 processed active peptides) of somatostatins are known in the art.
[000243] In particular embodiments, the vector may comprise a secretory signal as described in U.S. Patent No. 7,071,172.
[000244] In representative disclosure modalities, the virus vector and / or virus capsid is administered to the central nervous system (for example, the brain or the eye). The virus and / or capsid vector can be introduced into the spinal cord, brain stem (medulla oblongata, pons), midbrain (hypothalamus, thalamus, epithelium)
Petition 870190078272, of 8/13/2019, p. 260/335
86/120 mo, pituitary gland, substantia nigra, pineal gland), cerebellum, telencephalon (striatum, brain including occipital, temporal, parietal and frontal lobes, cortex, basal ganglia, hippocampus and portaamygdala), limbic system, neocortex, body striatum, brain, and inferior colliculus. The virus and / or capsid vector can also be administered in different regions of the eye such as the retina, cornea and / or optic nerve.
[000245] The virus and / or capsid vector can be released into the cerebrospinal fluid (for example, by lumbar puncture) for further dispersed administration of the release vector. The virus and / or capsid vector can additionally be administered intravascularly to the central nervous system in situations where the blood-brain barrier has been disturbed (for example, brain tumor or cerebral infarction).
[000246] The virus and / or capsid vector can be administered to one or more desired regions of the central nervous system by any route known in the art, including, but not limited to, intracerebroventricular, intracisternal, intraparenchymal, intracranial, intrathecal, intraocular , intracerebral, intraventricular, intravenous (for example, in the presence of a sugar such as mannitol), intranasal, intra-aural, intraocular (for example, intravitreal, sub-retinal, anterior chamber) and periocular (for example, sub-Tenon region ) as well as intramuscular release with retrograde release for motor neurons.
[000247] In particular modalities, the virus and / or capsid vector is administered in a liquid formulation by direct injection (for example, stereotactic injection) to the desired region or compartment in the central nervous system. In other embodiments, the virus and / or capsid vector can be provided by topical application to the desired region or by intranasal administration of an ae formulation.
Petition 870190078272, of 8/13/2019, p. 261/335
87/120 rosol. Administration to the eye can be by topical application of liquid droplets. As an additional alternative, the virus and / or capsid vector can be administered as a solid, slow-release formulation (see, for example, U.S. Patent No. 7,201,898).
[000248] In yet additional modalities, the virus vector can be used for retrograde transport to treat and / or prevent diseases and disorders involving motor neurons (for example, amyotrophic lateral sclerosis (ALS); spinal muscular atrophy (SMA), etc. ). For example, the virus vector can be released into muscle tissue from which it can migrate into neurons.
[000249] The following examples are included here, in this patent application, for purposes of illustration only, and are not intended to be limiting
EXAMPLES EXAMPLE 1. DISCOVERY OF A NEUROTHROPIC FOOTPRINT THAT ENABLES AAV TRANSPORTATION THROUGH THE HEMATOENCEPHALIC BARRIER
[000250] Adeno-associated viruses (AAV) are non-pathogenic parvoviruses composed of a small, 25 nm icosahedral capsid that packages an approximately 4.7 kb single-stranded DNA genome. A wide range of AVV capsid sequences have been isolated from human and primate tissues, which have been categorized into several distinct clades based on sequence and structural diversity. Among these clades, different serotypes have wide tropism at the species, tissue and cellular levels. These diverse phenotypes are determined by the structure of the capsid. The AVV capsid is assembled from 60 viral protein (PV) subunits. The core VP monomer (VP3) has a jelly roll structure, and a beta barrel composed of 7 antiparallel beta chains connected by interdigitating loop regions. Servings
Petition 870190078272, of 8/13/2019, p. 262/335
88/120 of these highly variable loops are exposed on the surface and define the topology of the AVV capsid, which in turn determines tissue tropism, antigenicity and the use of receptors through the various AVV serotypes. The superficial loop residues on the AVV capsid are highly plastic and susceptible to modification, providing control over antigenicity, the transduction profile and tissue tropism.
[000251] The first stage in the life cycle of AAV is recognition and attachment to cell surface glycan receptors. These include heparan sulfate (HS) for AAV2, AAV3 and AAV6, sialic acid linked to a2,3- and a2,6-N (Sia) for AAV1, AAV5 and AAV6, sialic acid linked to O for AAV4, and galactose ( Gal) for AAV9. Secondary to glycan binding, cellular uptake of AAV implies secondary coreceptors, including several growth factor receptors as well as integrins. Recently, a transmembrane protein, KIAA0319L (AAVR) has been identified as a universal receptor for multiple AVV serotypes. These factors, together with tissue glycosylation patterns, contribute to the variable tissue tropisms of different AVV serotypes. Particularly with respect to the central nervous system, different AVV serotypes have a spectrum of transduction profiles and cellular tropisms, depending on the route of administration. For example, when directly administered to the central nervous system of mice through either direct intraparenchymal or cerebrospinal intraliquid (CSF) injections, AVV capsids undergo axonal transport and transinaptic dissemination in the anterograde and / or retrograde directions, depending on the serotype. In addition, we recently showed that the lymphatic (glymphatic) transport associated with cerebrospinal fluid glia influences the dissemination of AAV within the mouse brain parenchyma and the clearance of the central nervous system.
Petition 870190078272, of 8/13/2019, p. 263/335
89/120
[000252] In order to carry out genetic transfer in the central nervous system, AAV vectors administered intravenously must first cross the blood-brain barrier (BBB) in order to gain entry into the brain. Composed of firm junctions of endothelial cells together with astrocytic end-feet and associated pericytes, the blood-brain barrier blocks the diffusion and paracellular flow of macromolecules / particles and regulates the transport of other molecules. Most viruses, which infect the brain, do so by disrupting or weakening the blood-brain barrier; however, some viruses have devised strategies to gain entry into the central nervous system by methods such as hitchhiking into host immune cells (for example, HIV), infecting brain endothelial cells or infecting peripheral nerves and exploiting axonal transport ( for example, the rabies virus). In the case of AAV, the blood-brain barrier prevents most serotypes from entering the brain with a few notable exceptions. For example, intravascular administration of AVV serotypes 1-6 and 8 results in low central nervous system transduction, whereas isolates of AAV9, AAVrh.8 and AAVrh.10, among others, have been shown to effectively cross blood-brain barrier in different animal models.
[000253] In order to obtain therapeutic levels of transgene expression in the central nervous system, high doses of vectors (for example, 1 χ 10 ¹⁴ vg / kg in the NCT02122952 spinal muscular atrophy test) are often required. In addition to the burden associated with increased scale and costs, high doses of vectors have also been shown to cause undesirable side effects such as liver toxicity. In order to improve the specificity / efficiency of gene transfer to the central nervous system and reduce the effective vector dose, a better understanding of
Petition 870190078272, of 8/13/2019, p. 264/335
90/120 structural features that allow AVV capsids to penetrate the blood-brain barrier.
[000254] To dissect correlations of structure and function to cross the blood-brain barrier, a combinatorial library of variant capsid genes was generated using only two serotypes AAV1, which does not cross the vasculature, and AAVrh.10, which is known to cross effectively the blood-brain barrier. Instead of developing new variants, individual variants were selected by computational, phylogenetic and structural analysis for additional screening in mice.
Production of a panel of chimeric AA V capsids.
[000255] A library of AAV1 / rh.10 domain exchange capsids was generated through DNA scrambling. In summary, the Cap genes of AAV1 and AAVrh.10 were fragmented randomly by brief DNase digestion and reassembled using primerless PCR (without primer) with Phusion High-Fidelity DNA polymerase (NEB Cat no. M0530L) in which the partial homology of the fragments short (<400 bp) allows the autopriming of the fragments. A secondary PCR step using specific conserved primers flanking the Cap gene was then used to amplify the full length reassembled Cap sequence library and simultaneously insert flanking restriction sites to facilitate subsequent cloning into a pTR plasmid structure used for production of the virus.
Phylogenetic and sequence analysis
[000256] The amino acid sequences of different isolated AVV capsids were aligned using ClustalW and phylogenetic trees were generated using the MEGAv7.0.21 software package. Phylogeny was produced using the neighboring union algorithm and the distances between amino acids were calculated using a correction
Petition 870190078272, of 8/13/2019, p. 265/335
91/120 of Poisson. Statistical testing by bootstrapping was performed with 1,000 replicates to test the reliability of phylogenetic analysis and to generate the bootstrap consensus tree. Branches corresponding to partitions reproduced in less than 50% of bootstrap replicates are collapsed. The percentage of replicate trees in which the associated rate grouped together in the bootstrap test is shown next to the branches. All sequence alignments were performed using Invitrogen's Vector NTI Advance 11.5.2 software.
Production of viruses and titles
[000257] An updated triple plasmid transfection protocol was used to produce recombinant AAV vectors. Specifically, the transfected plasmids include (i) a capsid-specific pXR helper plasmid (i.e., pXR1, pXRrh.10, or several plasmids encoding the various chimeric Cap genes used in this study), (ii) the adenoviral helper plasmid pXX680, and (iii) or plasmids pTR-CBh-scGFP or pTR-CBA-Luc (encoding or a self-complementing green fluorescent protein (GFP) transporter transgene controlled by the hybrid chicken beta actin (CBh) promoter or a reporter luciferase transgene (Luc ) controlled by the chicken beta actin promoter (CBA), respectively, flanked by inverted terminal repeats (TRs) derived from the AAV2 genome. Viral vectors were purified using iodixanol density gradient ultracentrifugation. Vectors that package a CBh transgene -scGFP were then subjected to buffer exchange and concentration using 100 kDa molecular weight cutting centrifugation (MWCO) columns Sartorius Vivaspin2 (F-2731-100 Bioe xpress, Kaysville, UT). Vectors that package a CBA-Luc transgene were subjected to buffer exchange and desalting using Zeba Spin desalting columns
Petition 870190078272, of 8/13/2019, p. 266/335
92/120 (Zeba Spin Desalting Columns), 40K MWCO (Thermo Scientific, Cat no. 87770). After purification, viral genome titers were determined by quantitative PCR using a Roche Lightcycler 480 (Roche Applied Sciences, Pleasanton, CA). Quantitative PCR primers were designed to specifically recognize AAV2 inverted terminal repeats (forward, 5'- AACATGCTACGCAGAGAGGGAGTGG -3 '; (SEQ ID NO: 36) reverse, 5'CATGAGACAAGGAACCCCTAGTGATGGAG -3') (SEQ ID NO: 37) (IDT Technologies, Ames IA).
Animal studies
[000258] All animal experiments were performed using 6 to 8 week old female C57 / BL6 mice purchased from Jackson Laboratories (BAR Harbor, ME). These mice were maintained and treated in accordance with NIH guidelines and as approved by the UNC Institutional Animal Care and Use Committee (IACUC, Institutional Animal Care and Use Committee). In order to investigate the ability of AAV vectors to cross the blood-brain barrier and transduce cell populations of the central nervous system, AAV vectors that package a CBh-scGFP or 1x PBS transgene (as a dummy treatment) were administered intravenously ( iv) by injection into the tail vein in a dose of 5 x 10 ¹¹ vg. To test for GFP transgene reporter expression, the animals were sacrificed 21 days after injection with tribromoethanol (Avertin) (0.2 ml 1.25% solution) followed by transcardial infusion with 30 ml 1x PBS followed by 30 ml of 4% paraformaldehyde in PBS. The tissues, including the brain, heart and liver, were removed and powders fixed for 24 h, and 50 pm thick sections were obtained for each tissue using a Leica VT 1200S vibrating slide microtome (Leica Biosystems, IL). The mouse brain sections were
Petition 870190078272, of 8/13/2019, p. 267/335
93/120 then immunostained as described below. For in vivo luciferase transduction and viral genome biodistribution experiments, the mice were injected either with 1x PBS or with viral vectors that package a CBA-Luciferase transgene at a dose of 1 x 10 ¹¹ vg. The mice were sacrificed, as described above, within 14 days after the injection and several tissues were removed. For these experiments, no fixation was performed with 4% paraformaldehyde in 1x PBS and instead the tissues were dissected and frozen at -80 ° C before using.
[000259] To quantify the expression of luciferase, mice injected with 1 x 10 ¹¹ viral genomes that package a CBA-Luc transgene were sacrificed 14 days after injection and the tissues were collected and frozen at -80 ° C. The tissues were then thawed, weighed and lysed by adding 150 μΙ of 2x passive lysis buffer (Promega, Madison Wl) before mechanical lysis using a Tissue Lyser II 352 instrument (Qiagen, Valencia, CA) followed by centrifugation to remove any debris from remaining tissue. To measure the expression of the luciferase transgene, 50 μΙ of supernatant from each lysate was then loaded onto a test plate along with 50 μΙ of luciferin and luminometric analysis was performed using a Victor2 luminometer (PerkinElmer, Waltham, MA). The relative light units obtained for each sample were then normalized to the weight of the input tissue for each sample, measured in grams. The data were plotted and statistical analyzes were performed using a two-tailed unpaired T-test with Welch correction as well as ANOVA followed by Tukey's multiple comparisons test where indicated. These statistical analyzes were performed using the GraphPad Prism 6® software.
Tissue processing and histological analysis
[000260] For experiments on mice using empaco
Petition 870190078272, of 8/13/2019, p. 268/335
94/120 virus treatment of a GFP reporter transgene, cerebral coronal sections of 50 pm thick floats were stained in 24-well plates. The sections were incubated in blocking buffer containing 10% goat serum and 1% Triton X (SigmaAldrich) in 1x PBS for 1 hour at room temperature. The sections were then incubated at 4 ° C overnight with a primary rabbit monoclonal antibody α-GFP (Life-Technologies-G10, 362 1: 750) diluted in blocking buffer. The next day, three 10-minute washes were performed with 1x PBS. Subsequent histochemical analysis of GFP expression was performed using a Vectastain ABC kit (Rabbit IgG PK-4001 kit, Vector biolabs, Burlingame, CA) and the tissues were mounted on microscopic slides. The immunostained sections were studied by digital images in bright field (20x objective) using an Aperio ScanScope XT instrument (Aperio Technologies, Vista, CA) by UNC Translational Pathology Laboratory and images were obtained using Leica eSlide Manager (image storage software and centralized data management) and analyzed using Aperio ImageScope and the WebViewer software. Quantifications were calculated by counting the number of neuronal or glial GFP + cells, determined based on morphology, per 50 pm of coronal brain section. The data were graphed and statistical analyzes were performed as summarized above. Specific brain regions were identified based on comparison to a coronal mouse brain reference obtained from the Allen Mouse Brain Atlas. To test for GFP expression in the heart and liver, tissues were stained for GFP with the primary anti-GFP antibody as described above; however, a goat anti-rabbit antibody conjugated to Alexa-488 was used as the secondary antibody at a dilution of 1: 500 (Abeam anti-rabbit - 96,883). Immunostained GFP in these tissues was then
Petition 870190078272, of 8/13/2019, p. 269/335
95/120 all images using an EVOS FL epifluorescence cell imaging system (AMC / Life Technologies) using the GFP light cube (470 nm excitation, 510 nm emission). Statistical analyzes were performed as summarized earlier.
Biodistribution of vector genomes
[000261] Animal studies were performed as described above. In 21 days after the injection, the mice were sacrificed and the tissues were frozen at -80 ° C. Then the tissues were thawed and the viral genomes were extracted from the tissue lysates using the DNeasy kit (Qiagen, Valencia, CA). Next, the viral genome copy numbers for each tissue were determined using quantitative PCR with primers specific for the luciferase transgene (forward, 5'- AAAAGCACTCTGATTGACAAATAC-3 '(SEQ ID NO: 38); and reverse, 5'CCTTCGCTTCAAAAAATGGAAC- 3 '(SEQ ID NO: 39)). These copy numbers of the viral genomes were then normalized to the mouse B2 housekeeping gene using the primers (forward, 5'-GGACCCAAGGACTACCTCAAGGG-3 '(SEQ ID NO: 40); and reverse, 5'-AGGGCACCTCCATCTCGGAAAC -3' (SEQ ID NO: 41)). Biodistribution of viral genomes is represented as the proportion of vector genomes per cell recovered for each tissue. The data are graphed and statistical analyzes were performed as previously described.
Molecular modeling
[000262] Previously published coordinates (PDB ID, 3NG9) were used to generate three-dimensional structures of the AAV1 VP3 trimer / triple symmetry axis. Homology models of AAVrh.10 and various structures of the chimeric capsids AAV1 / rh.10 were obtained using the SWISS-Model server (swissmodel.exDasv.org), with the crystal structure of AAV8 VP3 (PDB ID, 2QA0) used as a mo
Petition 870190078272, of 8/13/2019, p. 270/335
96/120 and a structure-based alignment was generated using the application of secondary structure correspondence (SSM) in the WinCoot software, with the monomer AAV1 VP3 (PDB ID 3NG9) being used as a model. The VP3 trimers / triple symmetry shafts, VP3 trimer dimers / double symmetry shafts, VP3 pentamers / quintuple symmetry shafts, and complete capsids were generated using the VIPERd oligomer generator utility (vl · Derdb.scriDDs.edu/oliqomer multi .php). Surface rendered representations of these models were visualized using PyMOL (the PyMOL Molecular Graphics System, SchrÕdinger LLC, www.pymol.org) · Projections of stereographic maps of the AAV1RX capsid surface highlighting amino acid residues exposed to the surface within the AAVrh-derived neurotropic footprint. 10 were generated using the software RIVEM (Radial Interpretation of Viral Electron Density Maps).
Generation of an AAV1 / rh domain exchange library. 10 and isolation of chimeric capsid variants
[000263] A comparative analysis of different capsid domains was performed to determine correlations of structure and function to cross the blood-brain barrier. A library of AAV1 / rh.1O domain exchanges was generated through DNA scrambling. AAV1 and AAVrh.10 were selected as parental capsid sequences for DNA shuffling since they differ markedly in their ability to cross the blood brain barrier and due to the sequence homology (85%) shared by their capsid (Cap) genes. Thirty-six sequences of chimeric capsids were then isolated clonally and sequenced. The variants generated from this library showed substantial diversity at the DNA and amino acid level. Sequence alignment revealed a spectrum of
Petition 870190078272, of 8/13/2019, p. 271/335
97/120 domains, which were then organized to increase the homology of AAV1 to AAVrh.10 (FIG. 4A, top to bottom). This panel of clones was further characterized phylogenetically by building a neighboring union tree, which broadly categorized these variants as either more similar to AAV1 (Clade A) or more similar to AAVrh.10 (Clade E) (FIG. 4B). Then, small scale vector production was used to establish relative titers to exclude defective capsids in the assembly or packaging of the study. Structural models were generated, based on homology, of parental and representative chimeric capsid trimers highlighting key surface domains / residues on the triple symmetry axis (FIG. 4C) to further narrow the list of chimeric capsid variants for initial in vivo screening . Ten variants of chimeric capsids were selected based on structural analyzes, of which six produced recombinant vectors (which package scGFP or ssLuc transgene cassettes) in titles similar to parental AAV1 and AAVrh.10 vectors. These variants were then further screened.
In vivo screening identifies two chimeric AAV1 / rh capsids. 10 able to cross the blood-brain barrier after intravenous administration in adult mice
[000264] It was then tested whether the selected panel of capsid variants would differ in their ability to cross the blood-brain barrier and transduce the central nervous system after IV administration. It is important to note that our approach does not involve targeted evolution, since this strategy it is generally applicable for the selection of optimal and less convenient capsids for the study of structure and function relationships. 6 to 8 week old mice were injected with a dose of 5 x 10 ¹¹ viral genomes (vg) per mouse of AAV1, AAVrh.10, or one of
Petition 870190078272, of 8/13/2019, p. 272/335
98/120 six different chimeric AAV vectors that package a self-supplementing CBh-GFP reporter cassette by injection into the tail vein.
[000265] Neurons positive for GFP in the cerebral cortex were manually counted, quantified and averaged across multiple coronal brain sections per mouse. n = 2 for AAV1; n = 3 for AAV1R6 and AAV1R7 (FIG. 1). Immunostaining of coronal brain sections at three weeks after injection revealed that AAV1 transduction in the cerebral cortex was limited to the vasculature whereas AAVrh.10 demonstrated robust transduction of various cell populations, including neurons, glial and endothelial cells, as determined morphologically (FIG. 2, FIG. 5). Subsequent morphological evaluation of GFP + cells indicates different phenotypes for the chimeric variants. AAV1R19.1 and AAV1R20 predominantly transduce microvascular endothelial cells in the cortex, while low modest transduction of neuronal and glial cells is evident for the AAV1R8 and AAV1 R19d vectors (FIG. 5). In contrast, AAV1R6 and AAV1R7 demonstrate robust transduction of cortical neurons with modest glial transduction and little, if any, vasculature transduction within the cortex. Representative images of the somatosensory area of the cortex in high magnification are shown. A similar trend for these chimeras has been observed consistently across other regions of the brain (FIG. 6). These observations indicate that the chimeric capsids AAV1R6 and AAV1R7 probably have the ability to cross the blood-brain barrier, similar to the parental vector AAVrh.10, although the mechanism is unknown. However, unlike any parent, AAV1 or AAVrh.10, no chimera effectively transduces the vasculature.
Chimeric capsids AAV1R6 and AAV1R7 released intravenously cross the blood-brain barrier and transduce neurons
Petition 870190078272, of 8/13/2019, p. 273/335
99/120 preferably throughout the brain.
[000266] The transduction profiles of these variants were then further characterized through multiple functionally relevant brain structures. For each of the brain regions discussed below, representative images were obtained at greater magnification of coronal sections of the mouse brain immunostained for GFP and scanned in a bright field at 20x magnification. In addition, quantitative data for neuronal and glial transduction for each region were determined by counting GFP + neuronal and glial cells, respectively, based on cell morphology.
[000267] Cerebral Cortex. AAVrh.10 exhibits robust transduction of neuronal, glial and vascular endothelial cells throughout the cortex and, in the case of AAV1 released intravascularly, vascular transduction was observed accompanied by the absence of neuronal expression and low levels of glial expression (FIG. 7 and FIG. 8). It was also observed that the vectors AAV1R6 and AAV1R7 (AAV1R6 / 7) administered intravenously mediate robust expression of GFP in the cortical neurons and reduced expression in the glia throughout the tonsillar, pyriform, entorhinal, temporal, auditory, somatosensory, motor areas , posterior parietal and retrosplenial cortex, but varied at levels consistently tending across the analyzed sections. Representative images of transduced cortical regions are shown for the motor cortex (FIG. 7A) and the somatosensory area of the cortex (FIG. 7B). In addition, AAV1R6 / 7 seems to present a cellular tropism, preferably neuronal throughout the entire cortex, presenting moderate glial transduction and notably reduced vascular transduction. This profile is in distinct contrast to the vasculotropic AAV1 as well as the AAVrh.10, which transduces neuronal, glial, and vascular endothelial cells with high efficiency (FIG. 7A and 7B). Although AAV1R6 / 7 measure robust
Petition 870190078272, of 8/13/2019, p. 274/335
100/120 glial neuronal and moderate expression throughout the cortex, its levels of expression are nevertheless lower than those obtained by AAVrh.10. These trends are corroborated by quantifying our morphological analysis of GFP + cells (FIG. 8A and 8B), which present a statistically significant difference in cortical transduction in relation to AAV1 for AAVrh.10, AAV1R6 and AAV1R7. A final difference to note is that the transduction of AAVrh.10 through the cortex has a tendency to be concentrated in the peripheries of the tissue, around the cortical layers 1 to 3, particularly within the retro-splenial, motor, somatosensory and visual cortical areas. Although this can be attributed to differential immunostaining, this phenomenon was observed with high consistency through the sections of AAVrh.10 stained in our analysis. This trend is not maintained for AAV1R6 / 7, which seem to mediate an expression more evenly distributed across the cortical layers.
[000268] Hippocampus. After intravenous release, the chimeric AAV1R6 / 7 vectors appear to mediate robust GFP expression in neurons throughout the hippocampus, bilaterally through the cerebral hemispheres. Neurons of the hippocampus GFP + are observed within the pyramidal layers CA1, CA2 and CA3 (FIG. 7C, shown CA2 and partial CA1). AAV1R6 / 7 also appear to be effective in transducing neurons within the dentate gyrus, presenting a large number of GFP + neurons which appear to be granular cells based on morphology (FIG. 7D). The neuronal transduction profile presented by AAV1R6 / 7 in the hippocampus is similar to that seen for AAVrh.10. However, in contrast to AAVrh.10, AAV1R6 / 7 does not appear to transduce either glial or endothelial cells in any region at any appreciable level, with no significant difference in GFP + glial cells observed between AAV1 and AAV1R6 / 7 (FIG. 8C and 8D). Again, the AAV1 transduction observed in the hippocam
Petition 870190078272, of 8/13/2019, p. 275/335
101/120 po is limited to the vasculature. In addition, these qualitative trends are corroborated by quantitative data for transduction of neuronal and glial cells in the hippocampus (FIG. 8C) and dentate gyrus (FIG. 8D). [000269] Thalamus. GFP + neurons were detected in the thalamus for AAV1R6 / 7 at levels comparable to AAVrh.10 (FIG. 7E). In addition, AAV1R6 / 7 demonstrate minimal endothelial transduction and dramatically reduced levels of glial transduction in the thalamus compared to AAVrh.10. These trends are further corroborated by quantitative data (FIG. 8E) in which the transduction of thalamic neurons was considered significantly different for AAVrh.10, AAV1R6 and AAV1R7, compared to AAV1. Conversely, no significant difference was seen for thalamic glial transduction for AAV1R6 / 7 compared to AAV1.
[000270] Hypothalamus. Although somewhat variable, consistently low levels of GFP expression, regardless of cell type, were observed within the hypothalamus for parental and chimeric vectors when administered systemically (FIG. 7F). Variation in the levels of neuronal transduction in the hypothalamus was observed for AAVrh.10, revealing high as well as low numbers of GFP + neurons among mice. This transduction profile is illustrated by the deviation shown for AAVrh.10 transduction in our quantitative data (FIG. 8F). AAV1 exhibits moderate hypothalamic transduction that is restricted to the vasculature. The AAV1R6 / 7 vectors demonstrate low numbers of glial cells and GFP + neurons in the hypothalamus, and a small number of GFP + endothelial cells (FIG. 7F and FIG.8F).
[000271] Striated body. AAV1R6 / 7 transduce neurons in the striatum (specifically, the caudate putamen) as effectively as AAVrh.10 (FIG. 7G), as further corroborated by our quantitative data demonstrating a significant difference for
Petition 870190078272, of 8/13/2019, p. 276/335
102/120 each in relation to AAV1; however, these vectors transduce glial cells ~ 2 times less and lower numbers of endothelial cells in the striatum (FIG. 8G) despite some variation observed. [000272] Amygdala. The tonsillar transduction profiles for AAV1R6 / 7 show robust expression of neuronal GFP, significantly different compared to AAV1. Few glial GFP + cells were detected, which were not significantly different compared to AAV1 (FIG. 7H and FIG. 8H), and barely detectable GFP + endothelial cells were observed, similarly to other brain regions such as the striatum and the thalamus.
[000273] Taken together, the morphological evaluation of immunostained brain regions derived from mice after intravenous release of AAV1R6 and AAV1R7 demonstrates robust and selective neuronal transduction comparable to parental AAVrh.10. In addition, these chimeras have reduced glial transduction and their ability to transduce cerebral microvasculature endothelial cells appears to be impaired. In addition, these results appear to be consistent across several brain regions, with the exception of the hypothalamus, where low levels of transduction are observed in general.
AAV1R6 and AAV1R7 are de-targeted from the liver while retaining parental cardiac transduction profiles
[000274] The relative cardiac and hepatic transduction of these variants was analyzed in comparison with parental serotypes by immunostaining the cardiac and hepatic sections. Female BL6 mice from 6 to 8 weeks of age were administered systemically through injections into the tail vein with a dose of 5 x 10 ¹¹ vg of vectors that package a hybrid chicken beta actin (CBh) promoter linked to a coding sequence ( CBh-scGFP) of green fluorescent protein (GFP) (or AAV1, AAV1R6 or AAV1R7) or
Petition 870190078272, of 8/13/2019, p. 277/335
103/120 with PBS as a negative control. The mice were sacrificed 21 days after the injection and the tissues were collected, fixed, and sectioned. Microscopy was used to visualize GFP reporter transduction. GFP expression was quantified by the mean relative fluorescence for multiple images per mouse using the ImageJ software. n = 1 for pseudo, n = 2 for AAV1 and n = 3 for AAV1R6 and AAV1R7.
[000275] As shown in FIG 10, both chimeric vectors demonstrate comparable levels of GFP expression in the heart in relation to the parental serotypes, AAV1 and AAVrh.10, with no significant difference found for AAVrh.10, AAV1R6 or AAV1R7, in relation to AAV1; however, levels of AAVrh.10 expression in cardiac tissue showed substantial variation between mice (FIG. 10A and 10B). In the liver, AAV1 demonstrated moderate levels of transduction while AAVrh.10 performed exceptionally well, demonstrating a logarithmically greater transduction. In contrast, AAV1R6 and AAV1R7 mediated expression of negligible GFP in the liver at background levels comparable to pseudo-treated mice (FIG. 10B) that were significantly reduced compared to AAVrh.10. Therefore, it was concluded that AAV1R6 and AAV1R7 are de-targeted by the liver in relation to their parental serotypes.
[000276] Separately, AAV vectors that package a chicken beta actin (CBA) promotes linked to a luciferase coding sequence to produce a CBA-luciferase transgene were administered to C57 / BI6 mice by injection into the tail vein in a dose of 1 x 10 ¹¹ vg. Mice were sacrificed 14 days after injection, tissues were collected, chopped, lysed, and luciferase assays were performed to detect levels of relative transduction to brain, cardiac, and hepatic tissues, and
Petition 870190078272, of 8/13/2019, p. 278/335
104/120 of the spinal cord. The data were normalized as relative light units per gram of tissue. In the brain, AAV1R6, AAV1R7 and AAV1RX have considerable levels of transduction, although not as high as AAVrh.10 (FIG. 3). Chimeric capsids additionally have transduction levels comparable to the parental capsules AAV1 and AAVrh.10 in the heart. In the spinal cord, the levels of transduction for chimeras appear to be intermediate between parents. Strikingly, these data further demonstrate that AAV1R6, AAV1R7 and AAV1RX are all detargeted from the liver. N = 3.
Structural analysis of the chimeric capsid AAV1R6 identifies three potential domains of AAVrh. 10 that can allow crossing the hematoence barrier
[000277] Sequence analysis revealed that AAV1R6 is 97 to 98% identical to AAV1 with 18 unique amino acid residues derived from AAVrh.10. AAV1R7 is also largely identical to AAV1, but with a total of 22 residues derived from AAVrh.10, including the 18 present in AAV1R6. Of the 4 additional residues unique to AAV1R7, two are located within the single VP1 N-terminal region (VP1u) (1891, 206A) and the other two are located in the buried VP3 N-terminal region (224S and 225S). As these residues are not exposed on the capsid surface and as the in vivo data suggest that the transduction profiles presented by AAV1R6 and AAV1R7 are equivalent (FIGS. 7 and 8), AAV1R7 was excluded from the rest of the analyzes and focused on AAV1R6 only .
[000278] AAV1R6 has 3 non-consecutive stretches of waste derived from the parental strain AAVrh.10. The first group of residues (group i) includes three amino acids (148P, 152R and 153S) within the VP1u region (FIG. 9A). Specifically, a waste is located adjacent to basic region 1 (BR1), which contains the first location sign Petition 870190078272, of 13/08/2019, p. 279/335
105/120 nuclear lysis (NLS) of VP1. In addition, group i contains two residues (158T and 163K) also close to the NLS located within the N-terminal VP2 region (FIG. 9A). As mentioned earlier, these residues are not exposed on the surface and instead remain internalized within the capsid until later in the intracellular trafficking pathway.
[000279] The second group of residues derived from AAVrh.10 over AAV1R6 (group ii) consists of 8 amino acids comprising the BC loop, located within the variable region I (VR-I) (FIG. 9A and 9B). These residues are exposed on the capsid surface at the base of the protrusions on the triple symmetry axis (FIG. 9D and 9F) and are also located for depression on the double symmetry axis (FIG. 9C and 9F). It is also important to note that this group of amino acid residues on AAVrh.10 is replaced with AAV1 residues in the chimeric capsules AAV1R8 / 19/20 which are unable to penetrate the central nervous system after systemic administration.
[000280] The third group of residues derived from AAVrh.10 present in AAV1R6 (group iii) includes a total of 6 amino acids. Four of these residues (328Q, 330E, 332T and 333K) are located in VRII, within the DE loop, which contributes to the formation of the pore on the quintuple symmetry axis (FIG. 9A, 9B, 9E, 9F). The last two residues remaining within this group (343I and 347T) are located within the β E chain, positioned inside the capsid (FIG. 9A and 9B). Although these residues differ between AAV1 and AAVrh.10, it should be noted that they are relatively conserved between different AVV serotypes.
Rational scheme of AAV1RX, a chimeric capsid with a minimal AA Vrh footprint. 10 to cross the blood-brain barrier [000281] Using a rational approach, the minimum number of AAVrh.10-derived amino acid residues on the handle has been narrowed
Petition 870190078272, of 8/13/2019, p. 280/335
106/120 of 1R6 that allow crossing the blood-brain barrier and confer tropism to the central nervous system. First, any amino acids that were not exposed on the capsid surface were excluded, eliminating stretches of residues located within the VP1 / 2 N-terminal regions of the capsid sequence (148P, 152R, 153S, 158T and 163K). Using the same reasoning, residues within the conserved β chain E (343I and 347T) were also excluded, as well as residues residing within VR-II, which is the pore formation loop connecting the β D and E chains (328Q, 330E , 332T and 333K). Through this approach, the footprint containing 8 amino acids (263N, 264G, 265T, 266S, 268G (an insertion in relation to the AAV1 sequence), 269S, 270T and 274T) found within VR-I, the loop linking the β B chains and C, in AAV1R6 was chosen for further evaluation (FIG. 11A and 11B). These residues exposed to the surface are located near the depression on the axis of double symmetry (FIG. 11Ce11F) and at the base of the triple protrusions (FIG. 11D and 11F). The projection of a stereographic map of residues exposed to the surface on the axis of triple symmetry highlights the topological orientation of these 8 residues in relation to the surrounding amino acids on the surface of the capsid (FIG. 11G). As mentioned earlier, it was also taken into account that these amino acids were absent in the AAV1R8 / 19/20 variants that were unable to transduce the brain parenchyma after systemic administration.
[000282] A chimeric capsid was then produced by grafting the 8 amino acid residues of AAVrh.10 onto the AAV1 serotype, naming this chimera AAV1RX. Female C57 / BI6 mice aged 6 to 8 weeks with AAV1 RX-CBh-scGFP vectors were administered at a dose of 5 x 10 µg per mouse by tail vein injection. The expression of GFP reporter in the brain was assessed by immunostaining in 21 days after the injection. According
Petition 870190078272, of 8/13/2019, p. 281/335
107/120 seen in FIG. 11H, AAV1RX transduces neurons within the motor cortex and cortical neurons across the entire cortex while demonstrating limited glial transduction and reduced vascular transduction, as seen previously with the chimeric capsids AAV1R6 and AAV1R7. Continuing this trend, numerous GFP + pyramidal neurons are observed in the hippocampus along with an abundance of granular GFP + cells in the dentate gyrus. Notably, GFP + glial and endothelial cells in these regions are largely absent. In the thalamus, AAV1RX demonstrates robust neuronal transduction at levels comparable to AAV1R6 and AAV1R7 with modest transduction of glial and endothelial cells, although at higher levels than for other brain regions. In the hypothalamus, GFP + neurons are sparse and few glial and vascular GFP + endothelial cells are observed. Finally, the neuronal transduction profile preferably presented by AAV1RX is also seen within the cooled body (specifically, the caudate putamen) and in the amygdala (FIG. 11H). Quantitative analyzes of these brain regions and comparisons with views for AAV1, AAVrh.10 and the chimeric vectors AAV1R6 and AAV1R7 suggest that this minimum footprint of 8 AAVrh.10 amino acid residues is crucial for crossing the blood-brain barrier (FIG. 13).
AAV1R6, AAV1R7 and AAV1RX mediate low levels of transduction and biodistribution in peripheral tissues.
[000283] In order to perform a comparative analysis of different chimeric capsids with parental serotypes, female C57 / BI6 mice from 6 to 8 weeks of age were injected through the tail vein with either AAV1, AAVrh.10, AAV1R6, AAV1R7 or AAV1RX that package a single chain luciferase reporter transgene controlled by a chicken beta actin promoter (ssCBA-Luc) at a dose of 1 x 10 µg per animal. Within 2 weeks after the injection, the mice were sacrificed and the tissues were
Petition 870190078272, of 8/13/2019, p. 282/335
108/120 collected. Assays for luciferase activity on tissue lysates as well as qPCR analyzes were performed to determine vector biodistribution (FIG. 12). All three chimeric vectors measured greater expression of the luciferase transgene and a corresponding increase in copies of the viral genome, for each, is observed within the brain compared to AAV1 (FIG. 12A and 12B). However, their levels of transgene expression and copy numbers of the viral genome were ~ 2 to 3 times lower in the brain compared to AAVrh.10, all of which were considered statistically significant, with the exception of AV1RX biodistribution (FIG. 12A and 12B). Similar transduction levels and copy numbers of the viral genome for AAV1R6, AAV1R7 and AAV1 RX were observed in the heart, comparable to those seen for AAV1, despite some variation in the levels of cardiac transduction observed for AAV1RX (FIG. 12C and 12D). AAVrh.10 mediates cardiac luciferase expression ~ 2 to 4 times greater and correspondingly copies of the viral genome ~ 2 times greater in the heart compared to the other vectors (FIG. 12C and 12D). As demonstrated by other groups, AAVrh.10 showed levels of luciferase transgene expression several times higher and consistently elevated copies of the viral genome in the liver. In contrast, low levels of luciferase expression background and significantly reduced viral genome copies were detected in the liver for AAV1, 1R6, 1R7 and 1 RX (FIG. 12E and 12F). It is noteworthy to mention that luciferase expression and a corresponding trend in viral genome copy numbers for AAVrh.10 were detected in the kidney (FIG. 12G and 12H). Although the three chimeric vectors had similar levels of viral genome copy numbers, the expression of luciferase in the kidney was absent. Taken together, these data seem to suggest that the chimeric vectors AAV1R6, 1R7 and 1 RX are de-targeted from the liver and can be cleared
Petition 870190078272, of 8/13/2019, p. 283/335
109/120 of blood circulation through the kidney.
[000284] After intravenous administration, a subgroup of chimeric capsids capable of crossing the blood-brain barrier and effectively transducing the central nervous system has been identified. It was seen that the ability to cross the blood-brain barrier is inversely correlated with infectivity in cell culture and sensitivity to neuraminidase. Structural modeling and map analysis additionally helped to identify several key waste clusters in AAVrh.10 that allow transport through the cerebral vasculature and disseminated neuronal transduction. Subsequently, the size of this footprint was further narrowed through a rational mutagenesis approach, which was then functionally validated in vivo. In conclusion, a minimal AAVrh.10 footprint was identified which, when grafted onto other AAV strains, allows transport across the blood-brain barrier and enables a more targeted central nervous system transduction profile compared to AAVrh.10. In addition, the resulting capsids are detargeted from the cerebral vasculature, the liver and other peripheral tissues. The functional mapping of this new neurotropic footprint provides a map for engineering synthetic AVV capsids for effective genetic transport of the central nervous system with an enhanced safety profile.
[000285] AAV1 and AAVrh.10, the parental serotypes used to generate the chimeric capsid library in this study, are both isolated from non-human primates belonging to two different clades - AAV1 belongs to clade A while AAVrh.10 is within from Clade E. Despite the evolutionary distance between them, they share -85% sequence homology between their Cap genes. AAV1 is known to recognize sialic acid bound to N (Sia) and the key residues composing Sia's recognition footprint only
Petition 870190078272, of 8/13/2019, p. 284/335
110/120 about the AAV1 capsid were recently reported. The current study identified 262N, 263G, 264T, 265S, 267G, 268S, 269T and 273T as key residues on the chimeric capsid AAV1RX, derived from AAVrh.10, which are essential to cross the blood-brain barrier. Although none of Sia's contact residues for AAV1 are located within the chimeric footprint 1RX, the carbonyl oxygen atoms in the structure of residues S268, D271, and N272 have been implicated in possibly stabilizing capsid-glycan interactions and increasing affinity connecting to Sia. In addition, residues in this position (D271 and N272) are located within the galactose binding footprint on AAV9. Therefore, the present study corroborates the notion that residues within VR-I are crucial.
[000286] The alignment of the VP3 sequences of natural AAV isolates reveals that the 8 amino acid residues that confer the central nervous system phenotype for AAV1RX are conserved in AAVrh.8 and AAVrh.39, other neurotropic capsids in Clade E (FIG . 14). Similarly, AAV8 and AAVrh.43, also located within Clade E, demonstrate the ability to cross the blood-brain barrier, although less effectively. Both have 7 of the 8 residues in this footprint; therefore, the introduction of the complete footprint on these capsids is likely to reinforce their ability to cross the blood-brain barrier.
[000287] Phenotypically, AAV1 and AAVrh.10 differ considerably in their ability to cross the blood-brain barrier and transduce neurons and glia in the brain. When released intravenously, AAV1 demonstrates preferential uptake and transduction in vascular endothelial cells. In contrast, AAVrh.10 appears not only to be picked up by and transduce vascular endothelial cells, but also to pass through the vasculaturea and transduce the underlying tissue, such as the central nervous system or skeletal muscle. The gift
Petition 870190078272, of 8/13/2019, p. 285/335
111/120 study identifies a minimal set of residues on the AAVrh.10 capsid that partially confers these traits to AAV1 capsids. Although this minimal footprint on the AAV1RX chimera appears essential to cross the blood-brain barrier and transduce neurons, transduction in peripheral tissues, such as the liver, is remarkably reduced, while cardiac expression remains similar to that of AAV1. These differences suggest that other structural domains on the AAVrh.10 capsid may play a role in conferring a systemic transduction profile. With respect to the cerebral parenchyma, it is important to note that after entering the central nervous system, the post-entry transduction profile of AAV1RX is preferably neuronal with reduced glial transduction compared to AAVrh.10. This can probably be attributed to the fact that most of the capsid is derived from AAV1, which is known to mediate preferentially neuronal transduction after intracerebroventricular injections. It is also possible that the unknown mechanism by which 1 RX crosses the blood-brain barrier mediates preferential neuronal uptake or that additional amino acid motifs / residues on the AAVrh.10 capsid may mediate post-entry steps in glial transduction.
[000288] From a clinical perspective, capsids that can cross the blood-brain barrier, preferably transduce neurons within the brain and that are simultaneously de-targeted by the liver can demonstrate an enhanced safety profile for gene transfer applications targeted to the central nervous system from a systemic route of administration. Reduced vector uptake in peripheral organs, particularly in the liver, can reduce the potential threat of hepatotoxicity, as evidenced by the transient rise in transaminases in the patient's serum after systemic injection of some AVV serotypes.
Petition 870190078272, of 8/13/2019, p. 286/335
112/120
[000289] AAV1R6 / 7 / X vectors can be widely used for global gene transfer in the central nervous system and in particular, for the development of gene therapy strategies to treat neurological disorders such as Friedreich's ataxia or spinal muscular atrophy.
Table 1.
Number ofAccess in Gen-BankNumber ofAccess onGenBankNumber ofAccess onGenBank Complete GenomesHu U17 AY695376 Hu66 AY530626 Adenoassociated viruses 1 NC_002077,AF063497 Hu T88 AY695375 Hu42 AY530605 Adenoassociated viruses 2 NC_001401 Hu T71 AY695374 Hu67 AY530627 Adenoassociated viruses 3 NC_001729 Hu T70 AY695373 Hu40 AY530603 Adenoassociated viruses 3B NC_001863 Hu T40 AY695372 Hu41 AY530604 Adenoassociated viruses 4 NC_001829 Hu T32 AY695371 Hu37 AY530600 Adenoassociated viruses 5 Y18065,AF085716 Hu T17 AY695370 Rh40 AY530559 Adenoassociated viruses 6 NC_001862 Hu LG15 AY695377 Rh2 AY243007 AAV AviaryATCC VR-865 AY186198,AY629583,NC_004828 Clade CBb1 AY243023 AAV Aviary strainDA-1 NC_006263,AY629583 Hu9 AY530629 Bb2 AY243022 AAV Bovine NC_005889,AY388617,AAR26465 Hu10 AY530576 AAV11 AAT46339,AY631966 Hu11 AY530577 Rh10 AY243015 AAV12 ABI16639,DQ813647 Hu17 AY530582 Clade AHu53 AY530615 Hu6 AY530621 AAV1 NC_002077,AF063497 Hu55 AY530617 Rh25 AY530557 AAV6 NC_001862 Hu54 AY530616 Pi2 AY530554 Hu.48 AY530611 Hu7 AY530628 Pi1 AY530553 Hu 43 AY530606 Hu18 AY530583 Pi3 AY530555 Hu 44 AY530607 Hu15 AY530580 Rh57 AY530569 Hu 46 AY530609 Hu16 AY530581 Rh50 AY530563
Petition 870190078272, of 8/13/2019, p. 287/335
113/120
Clade BHu25 AY530591 Rh49 AY530562 Hu. 19 AY530584 Hu60 AY530622 Hu39 AY530601 Hu. 20 AY530586 Ch5 AY243021 Rh58 AY530570 Hu 23 AY530589 Hu3 AY530595 Rh61 AY530572 Hu22 AY530588 Hu1 AY530575 Rh52 AY530565 Hu24 AY530590 Hu4 AY530602 Rh53 AY530566 Hu21 AY530587 Hu2 AY530585 Rh51 AY530564 Hu27 AY530592 Hu61 AY530623 Rh64 AY530574 Hu28 AY530593 Clade DRh43 AY530560 Hu 29 AY530594 Rh62 AY530573 AAV8 AF513852 Hu63 AY530624 Rh48 AY530561 Rh8 AY242997 Hu64 AY530625 Rh54 AY530567 Rh1 AY530556 Hu13 AY530578 Rh55 AY530568 Clade FHu56 AY530618 Cy2 AY243020 Hu14(AAV9) AY530579 Hu57 AY530619 AAV7 AF513851 Hu31 AY530596 Hu49 AY530612 Rh35 AY243000 Hu32 AY530597 Hu58 AY530620 Rh37 AY242998 IsolatedClonalHu34 AY530598 Rh36 AY242999 AAV5 Y18065,AF085716 Hu35 AY530599 Cy6 AY243016 AAV 3 NC_001729 AAV2 NC_001401 Cy4 AY243018 AAV3B NC_001863 Hu45 AY530608 Cy3 AY243019 AAV4 NC_001829 Hu47 AY530610 Cy5 AY243017 Rh34 AY243001 Hu51 AY530613 Rh13 AY243013 Rh33 AY243002 Hu52 AY530614 Clade ERh32 AY243003 Hu T41 AY695378 Rh38 AY530558
TABLE 2. Modifications of AAV1R7 in AAV serotypes 1, 2, 3,
6, 7, 8, 9, and rh10.
Modifications of Residue AAV1R7
AAV1 AAV2 AAV3 AAV6 AAV7 AAV8 AAV9 AAVrh.10 Q148P H148P Q148P Q148P P148P P148P Q148P P148P - -151Q -151Q - - - -151Q - E152R V151R Q152R E152R Q152R R152R Q152R R152R -153S E152S E153S -153S S153S S153S E153S S153S S157T S158T S158T S157T T158T T158T A158T T158T T162K A163K S163K T162K K163K K163K S163K K163K L188I L189I L189I L188I L189I L189I 11891 11891 S205A T206A S206A S205A A206A A206A S206A A206A N223S N224S N224S N223S N224S S224S S224S S224S A224S S225S S225S A224S A225S S225S S225S S225S S262N S263N S263N S262N S263N S263N N263N N263N A263G Q264G Q264G A263G E264G G264G S264G G264G S264T S265T S265T S264T T265T T265T T265T T265T T265S -266S G266S T265S A266S T266S S266S S266S
Petition 870190078272, of 8/13/2019, p. 288/335
114/120
-267G -267G -267G -267G -267G G267G G267G G267G - - -268G - - - - - A267S A269S A269S A267S S269S A269S S269S S269S S268T S270T S270T S268T T270T T270T S270T T270T H272T H274T H274T H272T T274T T274T A274T T274T T326Q Q328Q Q328Q T326Q T328Q Q328Q D328Q Q328Q D328E D330E D330E D328E D330E E330E N330E E330E V330T T332T T332T V330T V332T T332T V332T T332T T331K T333K T333K T331K T333K K333K K333K K333K V341I V343I V343I V341I I343I I343I V343I I343I S345T T347T T347T S345T S347T T347T T347T T347T
* The numbering is relative to the wild.
TABLE 3. Amino acid residues and abbreviations.
Amino acid residue Abbreviation Three Letter Code One Letter Code Alanine Allah THE Arginine Arg R Asparagine Asn N Aspartic Acid (Aspartate) Asp D Cysteine Cys Ç Glutamine Gin Q Glutamic acid (Glutamate) Glu AND Glycine Gly G Histidine His H Isoleucine lie I Leucine Read L Lysine Lys K Methionine Met M Phenylalanine Phe F Proline Pro P Serina To be s Threonine Thr T Tryptophan Trp w Tyrosine Tyr Y Valina Go V
REFERENCES
[000290] The following references are incorporated by reference here, in this patent application, in their entirety for all purposes.
1. Berns, K and Parrish, C (2007). Parvoviridae. Knipe DM, Howley PM, Griffin DE, Lamb PA, Martin MA, Roizman B, Straus SE (ed),
Petition 870190078272, of 8/13/2019, p. 289/335
115/120
Virol Fields. 5th ed, vol 11., Lippincott Williams & Wilkins, Philadelphia, PA: pp 2437-2477.
2. Gao, G, Vandenberghe, LH, Alvira, MR, Lu, Y, Calcedo, R, Zhou, X, et al. (2004). Clades of Adeno-associated viruses are widely disseminated in human tissues. J. V / ro /. 78: 6381-8.
3. Gao, G, Alvira, MR, Somanathan, S, Lu, Y, Vandenberghe, LH, Rux, JJ, et al. (2003). Adeno-associated viruses undergo substantial evolution in primates during natural infections. Proc. Natl. Acad. Sci. U. S. A. 100: 6081-6086.
4. Agbandje-McKenna, M and Kleinschmidt, J (2011). AAV capsid structure and cell interactions. Methods Mol. Biol. 807: 47-92.
5. Madigan, VJ and Asokan, A (2016). Engineering AAV receptor footprints for gene therapy. Curr. Opin. Virol. 18: 89-96.
6. Huang, LY, Halder, S and Agbandje-McKenna, M (2014). Parvovirus glycan interactions. Curr. Opin. Virol. 7C: 108-118.
7. Kashiwakura, Y, Tamayose, K, Iwabuchi, K, Hirai, Y, Shimada, T, Matsumoto, K, et al. (2005). Hepatocyte Growth Factor Receptor Is a Coreceptor for Adeno-Associated Virus Type 2 Infection. J. Virol. 79: 609-614.
8. Weller, ML, Amornphimoltham, P, Schmidt, M, Wilson, PA, Gutkind, JS and Chiorini, JA (2010). Epidermal growth factor receptor is a co-receptor for adeno-associated virus 26 serotype 6. Nat. Med. 16: 662-4.
9. Di Pasquale, G, Davidson, BL, Stein, CS, Martins, I, Scudiero, D, Monks, A, et al. (2003). Identification of PDGFR as a receiver for AAV5 transduction. Nat. Med. 9: 1306-12.
10. Asokan, A, Hamra, JB, Govindasamy, L, Agbandje-McKenna, M and Samulski, RJ (2006). Adeno-associated virus type 2 contains an integrin alpha5beta1 binding domain essential for viral cell entry. J. Virol. 80: 8961-9.
Petition 870190078272, of 8/13/2019, p. 290/335
116/120
11. Pillay, S, Meyer, NL, Puschnik, AS, Davulcu, O, Diep, J, Ishikawa, Y, et al. (2016). An essential receptor for adeno-associated virus infection. Nature 530: 108-112.
12. Murlidharan, G, Samulski, RJ and Asokan, A (2014). Biology of adeno-associated viral vectors in the central nervous system. Front. Mol. Neurosci. 7: 1-9.
13. Murlidharan, G, Crowther, A, Reardon, RA, Song, J and Asokan, A (2016). Glymphatic fluid transport controls paravascular clearance of AAV vectors from the brain. JCI Insight 1: 1-11.
14. Ballabh, P, Braun, A and Nedergaard, M (2004). The blood-brain barrier: An overview: Structure, regulation, and clinical implications. Neurobiol. Dis. 16: 1-13.
15. Williams, DW, Eugenin, EA, Calderon, TM and Berman, JW (2012). Monocyte maturation, HIV susceptibility, and transmigration across the blood brain barrier are critical in HIV neuropathogenesis. J. Leukoc. Biol. 91 ·. 401-15.
16. Salinas, S, Schiavo, G and Kremer, EJ (2010). A hitchhiker’s guide to the nervous system: the complex journey of viruses and toxins. Nat. Rev. Microbiol. 8: 645-655.
17. Yang, B, Li, S, Wang, H, Guo, Y, Gessler, DJ, Cao, C, et al. (2014). Global CNS transduction of adult mice by intravenously delivered rAAVrh.8 and rAAVrh.10 and nonhuman primates by rAAVrh.10. Mol. Ther. 22. 1299-1309.
18. Rosenberg, JB, Sondhi, D, Rubin, DG, Monette, S, Chen, A, Cram, S, et al. (2014). Comparative Efficacy and Safety of Multiple Routes of Direct CNS Administration of Adeno-Associated Virus Gene Transfer Vector Serotype rh.1O Expressing the Human Arylsulfatase A cDNA to Nonhuman Primates. Hum. Gene Ther. Dev.doi: 10.1089 / humc.2013.239 [doi].
19. Gray, SJ, Matagne, V, Bachaboina, L, Yadav, S, Ojeda, SR and
Petition 870190078272, of 8/13/2019, p. 291/335
117/120
Samulski, RJ (2011). Preclinical differences of intravascular AAV9 delivery to neurons and glia: a comparative study of adult mice and nonhuman primates. Mol. Ther. 19: 1058-1069.
20. Zhang, H, Yang, B, Mu, X, Ahmed, SS, Su, Q, He, R, etal. (2011). Several rAAV vectors efficiently cross the blood-brain barrier and transduce neurons and astrocytes in the neonatal mouse central nervous system. Mol. Ther. 19: 1440-1448.
21. Cearley, CN, Vandenberghe, LH, Parente, MK, Garnish, ER, Wilson, JM and Wolfe, JH (2008). Expanded repertoire of AAV vector serotypes mediate unique patterns of transduction in mouse brain. Mol. Ther. 16: 1710-8.
22. Grieger, JC, Snowdy, S and Samulski, RJ (2006). Separate Basic Region Motifs within the Adeno-Associated Virus Capsid Proteins Are Essential for Infectivity and Assembly. J. Virol. 80: 5199-5210.
23. Sonntag, F, Bieker, S, Leuchs, B, Fischer, R and Kleinschmidt, JA (2006). Adeno-associated virus type 2 capsids with externalized VP1 / VP2 trafficking domains are generated prior to passage through the cytoplasm and are maintained until uncoating occurs in the nucleus. J. Virol. 80: 11040-11054.
24. Bowles, DE, McPhee, SW, Li, C, Gray, SJ, Samulski, JJ, Camp, AS, et al. (2012). Phase 1 gene therapy for Duchenne muscular dystrophy using a translational optimized AAV vector. Mol. Ther. 20: 443455.
25. Li, C, Diprimio, N, Bowles, DE, Hirsch, ML, Monahan, PE, Asokan, A, et al. (2012). Single amino acid modification of adenoassociated virus capsid changes transduction and humoral immune profiles. J. Virol. 86: 7752-7759.
26. Bieker, S, Sonntag, F and Kleinschmidt, JA (2005). Mutational analysis of narrow pores at the fivefold symmetry axes of adenoassociated virus type 2 capsids reveals a dual role in genome packag
Petition 870190078272, of 8/13/2019, p. 292/335
118/120 ing and activation of phospholipase A2 activity. J. Virol. 79: 2528-2540.
27. Wu, Z, Miller, E, Agbandje-McKenna, M and Samulski, RJ (2006). Alpha2,3 and alpha2,6 N-linked sialic acids facilitate efficient binding and transduction by adeno-associated virus types 1 and 6. J. Virol. 80: 9093-103.
28. Huang, L-Y, Patel, A, Ng, R, Miller, EB, Halder, S, Mckenna, R, et al. Characterization of the Adeno-Associated Virus 1 and 6 Sialic Acid Binding Site: 10.1128 / JVI.00161 -16.
29. Bell, CL, Gurda, BL, Vliet, K Van, Agbandje-McKenna, M and Wilson, JM (2012). Identification of the galactose binding domain of the AAV9 capsid. J. Virol. 86: 7326-7333.
30. Rosenberg, JB, Sondhi, D, Rubin, DG, Monette, S, Chen, A, Cram, S, et al. (2014). Comparative efficacy and safety of multiple routes of direct CNS administration of adeno-associated virus gene transfer vector serotype rh.1O expressing the human arylsulfatase A cDNA to nonhuman primates. Hum. Gene Ther. Clin. Dev. 25: 164-77.
31. Cearley, CN and Wolfe, JH (2006). Transduction characteristics of adeno-associated virus vectors expressing cap serotypes 7, 8, 9, and Rh10 in the mouse brain. Mol. Ther. 13: 528-37.
32. Hadaczek, P, Forsayeth, J, Mirek, H, Munson, K, Bringas, J, Pivirotto, P, et al. (2009). Transduction of nonhuman primate brain with adeno-associated virus serotype 1: vector trafficking and immune response. Hum. Gene Ther. 20: 225-237.
33. Chen, S, Kapturczak, M, Loiler, SA, Zolotukhin, S, Glushakova, OY, Madsen, KM, et al. (2005). Efficient Transduction of Vascular Endothelial Cells with Recombinant Adeno-Associated Virus Serotype 1 and 5 Vectors. Hum. Gene Ther. 16: 235-247.
34. Pulicherla, N, Shen, S, Yadav, S, Debbink, K, Govindasamy, L, Agbandje-McKenna, M, et al. (2011). Engineering jver-detargeted AAV9 Vectors for Cardiac and Musculoskeletal Gene Transfer. Mol.
Petition 870190078272, of 8/13/2019, p. 293/335
119/120
The R. 19: 1070-1078.
35. Asokan, A, Conway, JC, Phillips, JL, Li, C, Hegge, J, Sinnott, R, et al. (2010). Reengineering a receptor footprint of adeno-associated virus enables selective and systemic gene transfer to muscle. Nat. Biotech nol. 28: 79-82.
36. Nathwani, AC, Reiss, UM, Tuddenham, EGD, Rosales, C, Chowdary, P, McIntosh, J, et al. (2014). Long-term safety and efficacy of factor IX gene therapy in hemophilia Β. N. Engl. J. Med. 371: 19942004.
37. Mingozzi, F and High, KA (2013). Immune responses to AAV vectors: overcoming barriers to successful gene therapy. Blood 122: 2336.
38. Kumar, S, Stecher, G and Tamura, K (2016). MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 33: 1870-4.
39. Saitou, N and Nei, M (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4: 40625.
40. Felsenstein, J (1985). CONFIDENCE LIMITS ON PHYLOGENIES: AN APPROACH USING THE BOOTSTRAP. Evolution (NY). 39: 783791.
41. Murlidharan, G, Sakamoto, K, Rao, L, Corriher, T, Wang, D, Gao, G, et al. (2016). CNS-restricted Transduction and CRISPR / Cas9mediated Gene Deletion with an Engineered AAV Vector. Mol. Ther. Nucleic Acids 5: e338.
42. Lein, ES, Hawrylycz, MJ, Ao, N, Ayres, M, Bensinger, A, Bernard, A, et al. (2007). Genome-wide atlas of gene expression in the adult mouse brain. Nature 445 '. 168-176.
43. Miller, EB, Gurda-Whitaker, B, Govindasamy, L, McKenna, R, Zolotukhin, S, Muzyczka N, et al. (2006). Production, purification and pre
Petition 870190078272, of 8/13/2019, p. 294/335
120/120 liminary X-ray crystallographic studies of adeno-associated virus serotype 1. Acta Crystallogr. Sect. F Struct. Biol. Cryst. Commun. 62: 1271-1274.
44. Bordoli, L, Kiefer, F, Arnold, K, Benkert, P, Battey, J and Schwede, T (2008). Protein structure homology modeling using SWISS-MODEL workspace. Nat. Protoc. 4: 1-13.
45. Nam, HJ, Lane, MD, Padron, E, Gurda, B, McKenna, R, Kohlbrenner, E, et al. (2007). Structure of adeno-associated virus serotype 8, a gene therapy vector. J. Virol. 81: 12260-12271.
46. Krissinel, E and Henrick, K (2004). Secondary-structure matching (SSM), a new tool for fast protein structure alignment in three dimensions. Acta Crystallogr. Sect. D Biol. Crystallogr. 60: 2256-2268.
47. Emsley, P, Lohkamp, B, Scott, WG and Cowtan, K (2010). Features and development of Coot. Acta Crystallogr. D. Biol. Crystallogr. 66: 486-501.
48. Carrillo-Tripp, M, Shepherd, CM, Borelli, IA, Venkataraman, S, Lander, G, Natarajan, P, et al. (2009). VIPERdb2: an enhanced and web API enabled relational database for structural virology. Nucleic Acids Res. 37: D436-42.
49. Xiao, C and Rossmann, MG (2007). Interpretation of electron density with stereographic roadmap projections. J. Struct. Biol. 158: 182—187.

权利要求:
Claims (127)
[1]
1. Adeno-associated virus (AAV) capsid protein, characterized by the fact that AAV capsid protein comprises a modification in the amino acid residues S262, A263, S264, T265, A267, S268 and H272, and a single insertion of amino acid residue between residues G266 and A267, (numbering VP1), where the numbering of each residue is based on the amino acid sequence of AAV1 (SEQ ID NO: 1) or the equivalent amino acid residue in AAV2 (SEQ ID NO : 2), AAV3 (SEQ ID NO: 3), AAV6 (SEQ ID NO: 4), AAV7 (SEQ ID NO: 5), AAV8 (SEQ ID NO: 6), AAV9 (SEQ ID NO: 7) or AAVrhIO (SEQ ID NO: 8).
[2]
2. AAV capsid protein according to claim 1, characterized by the fact that it also comprises a modification in amino acid residues Q148, E152, S157, T162, T326, D328, V330, T331, V341 and S345, and a single insertion of amino acid residue between residues E152 and P153 (numbering VP1) where the numbering of each residue is based on the amino acid sequence of SEQ ID NO: 1 or the equivalent amino acid residue in SEQ ID NOs: 2, 3, 4 , 5, 6, 7 or 8.
[3]
3. AAV capsid protein according to claim 2, characterized by the fact that it also includes a modification of amino acid residues L188, S205, N223 and A224 (VP1 numbering), in which the numbering of each residue is based on the sequence of amino acids of SEQ ID NO: 1 or the equivalent amino acid residue in SEQ ID NOs: 2, 3, 4, 5, 6, 7 or 8.
[4]
4. AAV capsid protein according to any one of claims 1 to 3, characterized by the fact that the modification is at least one of S262N, A263G, S264T, T265S, A267S, S268T and H272T.
[5]
5. AVV capsid according to any of the king
Petition 870190078272, of 8/13/2019, p. 296/335
2/19 vindications 1 to 2, characterized by the fact that the modification is at least one of Q148P, E152R, S157T, T162K, T326Q, D328E, V330T, T331K, V3411 and S345T.
[6]
6. AVV capsid according to claim 3, characterized by the fact that the modification is at least one of L188I, S205A, N223S and A224S.
[7]
7. AAV capsid protein according to claim 1, characterized by the fact that it comprises an amino acid sequence selected from the group consisting of:
a) the amino acid sequence of SEQ ID NO: 9 (AAV1RX);
b) the amino acid sequence of SEQ ID NO: 10 (AAV2RX);
c) the amino acid sequence of SEQ ID NO: 11 (AAV3RX);
d) the amino acid sequence of SEQ ID NO: 12 (AAV6RX);
e) the amino acid sequence of SEQ ID NO: 13 (AAV7RX);
f) the amino acid sequence of SEQ ID NO: 14 (AAV8RX); and
g) the amino acid sequence of SEQ ID NO: 15 (AAV9RX).
[8]
8. AVV capsid according to claim 2, characterized by the fact that it comprises an amino acid sequence selected from the group consisting of:
a) the amino acid sequence of SEQ ID NO: 16 (AAV1R6);
b) the amino acid sequence of SEQ ID NO: 17 (AAV2R6);
c) the amino acid sequence of SEQ ID NO: 18 (AAV3R6);
d) the amino acid sequence of SEQ ID NO: 19 (AAV6R6);
e) the amino acid sequence of SEQ ID NO: 20 (AAV7R6);
f) the amino acid sequence of SEQ ID NO: 21 (AAV8R6); and
g) the amino acid sequence of SEQ ID NO: 22 (AAV9R6).
[9]
9. AVV capsid according to claim 3, characterized by the fact that it comprises an amino acid sequence selected from the group consisting of:
a) the amino acid sequence of SEQ ID NO: 23 (AAV1R7);
Petition 870190078272, of 8/13/2019, p. 297/335
3/19
b) the amino acid sequence of SEQ ID NO: 24 (AAV2R7);
c) the amino acid sequence of SEQ ID NO: 25 (AAV3R7);
d) the amino acid sequence of SEQ ID NO: 26 (AAV6R7);
e) the amino acid sequence of SEQ ID NO: 27 (AAV7R7);
f) the amino acid sequence of SEQ ID NO: 28 (AAV8R7); and
g) the amino acid sequence of SEQ ID NO: 29 (AAV9R7).
[10]
10. AVV capsid characterized by the fact that it comprises the capsid protein as defined in any one of claims 1 to 9.
[11]
11. Virus vector characterized by the fact that it comprises:
(a) the AVV capsid as defined in claim 10; and (b) a nucleic acid comprising at least one terminal repeat sequence, in which the nucleic acid is encapsulated by the AVV capsid.
[12]
12. Composition characterized by the fact that it comprises the virus vector as defined in claim 11 in a pharmaceutically acceptable carrier.
[13]
13. Method of introducing a nucleic acid molecule into a cell, characterized in that it comprises contacting the cell with the virus vector as defined in claim 11 and / or the composition as defined in claim 12.
[14]
14. Method of releasing a nucleic acid molecule to a subject, characterized in that it comprises administering to the subject the virus vector as defined in claim 11 and / or the composition as defined in claim 12.
[15]
15. Method according to claim 14, characterized by the fact that the virus vector and / or composition is administered to the subject's central nervous system.
[16]
16. Method according to claim 15, characterized
Petition 870190078272, of 8/13/2019, p. 298/335
4/19 do by the fact that the virus vector and / or composition is released through the blood-brain barrier.
[17]
17. Method according to any one of claims 14, 15 or 16, characterized in that the virus vector comprises a nucleic acid molecule of interest.
[18]
18. Method of selectively releasing a nucleic acid molecule of interest to a neuronal cell, characterized by the fact that it comprises contacting the neuronal cell with the virus vector as defined in claim 11, wherein the virus vector comprises the molecule of nucleic acid of interest.
[19]
19. Method according to claim 18, characterized in that it further comprises selectively releasing a nucleic acid molecule of interest to a cardiomyocyte.
[20]
20. Method according to any one of claims 17, 18 or 19, characterized in that the nucleic acid molecule of interest encodes a therapeutic protein or a therapeutic RNA.
[21]
21. Method according to any one of claims 18, 19 or 20, characterized in that the neuronal cell and the cardiomyocyte are in a subject.
[22]
22. Method according to claim 21, characterized by the fact that the viral vector is detargeted from splenocytes, hepatocytes or renal cells.
[23]
23. The method of any one of claims 14 to 17, 21 or 22, characterized by the fact that the subject is a human subject.
[24]
24. Method of treating a neurological defect or disorder in a subject, characterized by the fact that it comprises administering to the subject the virus vector as defined in claim 11, wherein the virus vector comprises a naked acid molecule
Petition 870190078272, of 8/13/2019, p. 299/335
5/19 cleico that encodes a therapeutic protein or a therapeutic RNA effective in the treatment of the disorder or neurological defect.
[25]
25. Method of treating a neurological and cardiovascular disorder or defect in a subject, characterized by the fact that it comprises administering to the subject the virus vector as defined in claim 11, wherein the virus vector comprises a nucleic acid molecule that encodes a therapeutic protein or therapeutic RNA effective in the treatment of neurological and cardiovascular disorder or defect.
[26]
26. Method according to any one of claims 14 to 17, 21, 22, 23, 24 or 25, characterized in that the virus vector or composition is administered to the subject intravenously, intraarterially, or intraperitoneally.
[27]
27. Method according to any one of claims 14 to 17, 21, 22, 23, 24 or 25, characterized in that the virus vector or composition is administered to the subject via an intracerebroventrical, intracisternal, intraparenchymal, intracranial route and / or intrathecal.
[28]
28. The method of any one of claims 24 to 27, characterized in that the administration of the virus vector and / or composition to the subject systemically results in less transduction in off-target tissues.
[29]
29. Adeno-associated virus (AAV) capsid protein, characterized by the fact that AAV capsid protein comprises a modification in amino acid residues S262, A263, S264, T265, and A267 (VP1 numbering), and a single insertion of amino acid residue between residues S268 and N269, where the amino acid residues are based on the amino acid sequence of AAV1 (SEQ ID NO: 1) or the equivalent amino acid residues in AAV2 (SEQ ID NO: 2), AAV3 (SEQ ID NO: 3), AAV6 (SEQ ID NO: 4),
Petition 870190078272, of 8/13/2019, p. 300/335
6/19
AAV7 (SEQ ID NO: 5), AAV8 (SEQ ID NO: 6), AAV9 (SEQ ID NO: 7) or AAVrhW (SEQ ID NO: 8).
[30]
30. AAV capsid protein according to claim 29, characterized in that the capsid protein further comprises a modification in the amino acid residue H272.
[31]
31. AAV capsid protein according to claim 29 or 30, characterized in that the AAV capsid protein further comprises a modification in amino acid residues Q148, E152, S157, T162, H272, T326, D328, V330 , T331, V341 and S345, and a single insertion of amino acid residue between residues E152 and P153.
[32]
32. AAV capsid protein according to any one of claims 29 to 31, characterized in that the AAV capsid protein further comprises a modification in amino acid residues L188, S205, N223, A224, and H272.
[33]
33. AAV capsid protein according to any one of claims 29 to 32, characterized in that the modification is at least one of S262N, A263G, S264T, T265S, and A267S.
[34]
34. AAV capsid protein according to any one of claims 31 to 33, characterized in that the modification is at least one of Q148P, E152R, S157T, T162K, H272T, T326Q, D328E, V330T, T331K, V341I and S345T.
[35]
35. AAV capsid protein according to any one of claims 32 to 24, characterized in that the modification is at least one of L188I, S205A, N223S, A224S and H272T.
[36]
36. AAV capsid protein according to any one of claims 29 to 35, characterized in that the insertion of amino acid residue between residues S268 and N269 is an insertion of a single T residue.
Petition 870190078272, of 8/13/2019, p. 301/335
7/19
[37]
37. AAV capsid protein according to any one of claims 31 to 36, characterized in that the insertion of amino acid residue between residues E152 and P153 is an insertion of a single S residue.
[38]
38. AAV capsid protein according to claim 29, characterized by the fact that the amino acid sequence of the capsid protein is selected from the group consisting of:
a) the amino acid sequence of SEQ ID NO: 9 (AAV1RX);
b) the amino acid sequence of SEQ ID NO: 10 (AAV2RX);
c) the amino acid sequence of SEQ ID NO: 11 (AAV3RX);
d) the amino acid sequence of SEQ ID NO: 12 (AAV6RX);
e) the amino acid sequence of SEQ ID NO: 13 (AAV7RX);
f) the amino acid sequence of SEQ ID NO: 14 (AAV8RX); and
g) the amino acid sequence of SEQ ID NO: 15 (AAV9RX).
[39]
39. AAV capsid protein according to claim 38, characterized in that the amino acid sequence of the capsid protein is SEQ ID NO: 9 (AAV1 RX).
[40]
40. AAV capsid protein according to claim 31, characterized by the fact that the amino acid sequence of the capsid protein is selected from the group consisting of:
a) the amino acid sequence of SEQ ID NO: 16 (AAV1R6);
b) the amino acid sequence of SEQ ID NO: 17 (AAV2R6);
c) the amino acid sequence of SEQ ID NO: 18 (AAV3R6);
d) the amino acid sequence of SEQ ID NO: 19 (AAV6R6);
e) the amino acid sequence of SEQ ID NO: 20 (AAV7R6);
f) the amino acid sequence of SEQ ID NO: 21 (AAV8R6); and
g) the amino acid sequence of SEQ ID NO: 22 (AAV9R6).
[41]
41. AAV capsid protein according to claim 40, characterized in that the amino acid sequence of the capsid protein is SEQ ID NO: 16 (AAV1R6).
Petition 870190078272, of 8/13/2019, p. 302/335
8/19
[42]
42. AAV capsid protein according to claim 32, characterized by the fact that the amino acid sequence of the capsid protein is selected from the group consisting of:
a) the amino acid sequence of SEQ ID NO: 23 (AAV1R7);
b) the amino acid sequence of SEQ ID NO: 24 (AAV2R7);
c) the amino acid sequence of SEQ ID NO: 25 (AAV3R7);
d) the amino acid sequence of SEQ ID NO: 26 (AAV6R7);
e) the amino acid sequence of SEQ ID NO: 27 (AAV7R7);
f) the amino acid sequence of SEQ ID NO: 28 (AAV8R7); and
g) the amino acid sequence of SEQ ID NO: 29 (AAV9R7).
[43]
43. AAV capsid protein according to claim 42, characterized in that the amino acid sequence of the capsid protein is SEQ ID NO: 23 (AAV1R7).
[44]
44. Adeno-associated virus (AAV) capsid protein, characterized by the fact that the AAV capsid protein comprises a modification resulting in the amino acid sequence:
X ¹ -X ² -X ³ -X ⁴ in the amino acids corresponding to amino acid positions 262 to 265 (VP1 numbering) of the native AAV1 capsid protein (SEQ ID NO: 1), where X ¹ is any amino acid other than S ; where X ² is any amino acid other than A;
where X ³ is any amino acid other than S; and where X ⁴ is any amino acid other than T.
[45]
45. AAV capsid protein according to claim 44, characterized by the fact that the amino acid X ¹ is N.
[46]
46. AAV capsid protein according to claim 44, characterized by the fact that the amino acid X ² is G.
[47]
47. AAV capsid protein according to claim 44, characterized by the fact that the amino acid X ³ is T.
Petition 870190078272, of 8/13/2019, p. 303/335
9/19
[48]
48. AAV capsid protein according to claim 44, characterized by the fact that the amino acid X ⁴ is S.
[49]
49. AAV capsid protein according to claim 44, characterized by the fact that the amino acid X ¹ is N, X ² is G, X ³ is T, and X ⁴ is S.
[50]
50. AAV capsid protein according to any of claims 44 to 49, characterized in that the capsid protein further comprises a modification in the amino acid residue H272.
[51]
51. AAV capsid protein according to claim 50, characterized by the fact that the modification is H272T.
[52]
52. AAV capsid protein according to any of claims 44 to 51, characterized in that the AAV capsid protein further comprises an amino acid residue insert between the amino acid residues S268 and N269.
[53]
53. AAV capsid protein according to claim 52, characterized in that the insertion of an amino acid residue is an insertion of a single T residue.
[54]
54. Adeno-associated virus (AAV) vector characterized by the fact that it comprises the AAV capsid protein as defined in any one of claims 29 to 53.
[55]
55. AAV vector according to claim 54, characterized by the fact that it further comprises:
a nucleic acid comprising at least one terminal repeat sequence, wherein the nucleic acid is encapsulated by the AAV capsid protein.
[56]
56. AVV virus vector according to claim 55, characterized in that the terminal repeat sequence is an AAV terminal repeat.
[57]
57. AVV virus vector according to claim 55,
Petition 870190078272, of 8/13/2019, p. 304/335
10/19 characterized by the fact that the repetition sequence of the terminal is a repetition of the non-AAV terminal.
[58]
58. AVV virus vector according to any one of claims 55 to 57, characterized in that the nucleic acid further comprises a sequence encoding a therapeutic protein or a therapeutic RNA.
[59]
59. Pharmaceutical composition characterized by the fact that it comprises the virus vector as defined in any one of claims 54 to 58.
[60]
60. The pharmaceutical composition according to claim 59, characterized in that the composition further comprises a pharmaceutically acceptable carrier.
[61]
61. Method of introducing a nucleic acid molecule into a cell, characterized in that it comprises contacting the cell with the AVV virus vector as defined in any one of claims 54 to 59.
[62]
62. Method of introducing a nucleic acid molecule into a cell, characterized in that it comprises contacting the cell with the pharmaceutical composition as defined in claim 59 or 60.
[63]
63. The method of claim 61 or 62, characterized in that the virus vector or composition is administered to a subject's central nervous system.
[64]
64. The method of claim 63, characterized by the fact that the virus vector or composition is released through the blood-brain barrier.
[65]
65. The method of claim 61 or 62, characterized by the fact that the virus vector or composition is Retargeted from the liver.
[66]
66. The method of claim 61 or 62, character
Petition 870190078272, of 8/13/2019, p. 305/335
11/19 terized by the fact that the virus vector or composition is detargeted from the kidney.
[67]
67. Method according to claim 61 or 62, characterized in that the virus vector or composition is detargeted from the spleen.
[68]
68. Method of selectively releasing a therapeutic protein or therapeutic RNA to a neuronal cell in a subject, characterized in that it comprises contacting the neuronal cell with the virus vector as defined in any of claims 54 to 58 or the composition as defined in claims 59 to 60, wherein the virus vector or composition comprises the therapeutic protein or the therapeutic RNA.
[69]
69. The method of claim 68, characterized by the fact that the virus vector or composition is detargeted from the liver.
[70]
70. The method of claim 68, characterized in that the virus vector or composition is detargeted from the kidney.
[71]
71. The method of claim 68, characterized in that the virus vector or composition is detargeted from the spleen.
[72]
72. Method of treating a neurological defect or disorder in a subject, characterized in that the method comprises administering to the subject the virus vector as defined in any one of claims 54 to 58 or the composition as defined in claims 59 to 60 , wherein the virus vector or composition comprises a nucleic acid molecule encoding a therapeutic protein or therapeutic RNA effective in the treatment of neurological disorder.
[73]
73. The method of claim 72, characterized
Petition 870190078272, of 8/13/2019, p. 306/335
12/19 by the fact that it also includes the treatment of a disorder or cardiovascular defect in the subject.
[74]
74. The method of claim 72, characterized in that the virus vector or composition is selectively released to a neuronal cell.
[75]
75. Method according to claim 72, characterized in that the virus vector or the composition is selectively released to a cardiomyocyte.
[76]
76. The method of claim 72, characterized in that the virus vector or composition is detargeted from the liver, kidney and / or spleen.
[77]
77. Method according to any one of claims 61 to 76, characterized in that the subject is a mammal.
[78]
78. Method according to any of claims 61 to 77, characterized in that the subject is a human being.
[79]
79. Method according to any of claims 61 to 78, characterized in that the virus vector or composition is released to the subject via the administration route selected from the group consisting of intravenous, intraarterial, intraperitoneal, intracerebroventrical , intracisternal, intraparenchymal, intracranial, and intrathecal.
[80]
80. The method of claim 79, characterized in that the virus vector or composition is delivered to the subject through intravenous administration.
[81]
81. Adeno-associated virus (AAV) capsid protein, characterized by the fact that AAV capsid protein comprises a modification in the amino acid residues S262, A263, S264, T265, A267, and H272, and a single insertion of amino acid residue between residues S268 and N269, (numbering VP1), where the
Petition 870190078272, of 8/13/2019, p. 307/335
13/19 The numbering of each residue is based on the amino acid sequence of AAV1 (SEQ ID NO: 2) or the equivalent amino acid residue in AAV1 (SEQ ID NO: 1), AAV3 (SEQ ID NO: 3), AAV6 (SEQ ID NO: 4), AAV7 (SEQ ID NO: 5), AAV8 (SEQ ID NO: 6), AAV9 (SEQ ID NO: 7) or AAVrhIO (SEQ ID NO: 8).
[82]
82. AAV capsid protein according to claim 81, characterized in that the modification comprises at least one of S262N, A263G, S264T, T265S, A267G, and H272T.
[83]
83. AAV capsid protein according to claim 81 or 82, characterized in that the only amino acid residue insert between residues S268 and N269 is an insert of a single T residue.
[84]
84. AAV capsid protein according to any of claims 81 to 83, characterized in that the AAV capsid protein comprises the sequence of SEQ ID NO: 30 or SEQ ID NO: 33.
[85]
85. Adeno-associated virus (AAV) capsid protein, characterized by the fact that AAV capsid protein comprises a modification in the amino acid residues S262, Q263, S264, A266, S267, and H271, and an insertion of no minimum one amino acid residue between residues S261 and S262, (VP1 numbering), where the numbering of each residue is based on the amino acid sequence of AAV2 (SEQ ID NO: 2) or the equivalent amino acid residue in AAV1 (SEQ ID NO: 1), AAV3 (SEQ ID NO: 3), AAV6 (SEQ ID NO: 4), AAV7 (SEQ ID NO: 5), AAV8 (SEQ ID NO: 6), AAV9 (SEQ ID NO: 7) or AAVrhIO (SEQ ID NO: 8).
[86]
86. AAV capsid protein according to claim 85, characterized in that the modification comprises at least one of S262T, Q263S, S264G, A266S, S267T, and H271T.
[87]
87. AAV capsid protein according to claim
Petition 870190078272, of 8/13/2019, p. 308/335
14/19 cation 85 or 86, characterized by the fact that the insertion between residues SS61 and S262 is an insertion of a single amino acid residue.
[88]
88. AAV capsid protein according to claim 85 or 86, characterized in that the insertion between residues S251 and S252 is an insertion of more than one amino acid residue.
[89]
89. AAV capsid protein according to claim 88, characterized by the fact that the insertion between residues S251 and S252 is an insertion of an N and a G residue.
[90]
90. AAV capsid protein according to any one of claims 85 to 89, characterized in that the AAV capsid protein comprises the sequence of SEQ ID NO:
31.
[91]
91. Adeno-associated virus (AAV) capsid protein, characterized by the fact that AAV capsid protein comprises a modification in amino acid residues S262, Q263, S264, A266, A267, H271, and a single residue insertion of amino acid between residues S261 and S262, where the numbering of each residue is based on the amino acid sequence of AAV3 (SEQ ID NO: 3) or the equivalent amino acid residue in AAV1 (SEQ ID NO: 1), AAV2 (SEQ ID NO: 2), AAV6 (SEQ ID NO: 4), AAV7 (SEQ ID NO: 5), AAV8 (SEQ ID NO: 6), AAV9 (SEQ ID NO: 7) or AAVrhW (SEQ ID NO: 8) .
[92]
92. AAV capsid protein according to claim 91, characterized in that the modification comprises at least one of S262T, Q263S, S264G, A266S, A267T, H271T.
[93]
93. AAV capsid protein according to claim 91 or 92, characterized by the fact that the insertion between residues SS61 and S262 is an insertion of a single amino acid residue
Petition 870190078272, of 8/13/2019, p. 309/335
15/19 acid.
[94]
94. AAV capsid protein according to claim 91 or 92, characterized by the fact that the insertion between residues S251 and S252 is an insertion of more than one amino acid residue.
[95]
95. AAV capsid protein according to claim 94, characterized by the fact that the insertion between residues S251 and S252 is an insertion of an N and a G residue.
[96]
96. AAV capsid protein according to any of claims 91 to 95, characterized in that the AAV capsid protein comprises the sequence of SEQ ID NO:
32.
[97]
97. Adeno-associated virus (AAV) capsid protein, characterized by the fact that the AAV capsid protein comprises a modification in amino acid residues S263, S269, A237 (VP1 numbering), where the numbering of each residue is based on the amino acid sequence of AAV9 (SEQ ID NO: 9) or the equivalent amino acid residue in AAV1 (SEQ ID NO: 1), AAV2 (SEQ ID NO: 2), AAV3 (SEQ ID NO: 3), AAV6 ( SEQ ID NO: 4), AAV7 (SEQ ID NO: 5), AAV8 (SEQ ID NO: 6), or AAVrhW (SEQ ID NO: 8).
[98]
98. AAV capsid protein according to claim 97, characterized in that the modification comprises at least one of S263G, S269T, and A273T.
[99]
99. AAV capsid protein according to claim 97 or 98, characterized in that the AAV capsid protein comprises the sequence of SEQ ID NO: 34.
[100]
100. Adeno-associated virus (AAV) capsid protein, characterized by the fact that the AAV capsid protein comprises the sequence of any of SEQ ID NO: 9 to SEQ ID NO: 34.
Petition 870190078272, of 8/13/2019, p. 310/335
16/19
[101]
101. Adeno-associated virus (AAV) vector characterized by the fact that it comprises the AAV capsid protein as defined in any one of claims 81 to 100.
[102]
102. AAV vector according to claim 101, characterized by the fact that it further comprises:
a nucleic acid comprising at least one terminal repeat sequence, wherein the nucleic acid is encapsulated by the AAV capsid protein.
[103]
103. AVV virus vector according to claim 102, characterized in that the terminal repeat sequence is an AAV terminal repeat.
[104]
104. AVV virus vector according to claim 102, characterized in that the terminal repeat sequence is a non-AAV terminal repeat.
[105]
105. AVV virus vector according to any one of claims 101 to 104, characterized in that the nucleic acid further comprises a sequence encoding a therapeutic protein or a therapeutic RNA.
[106]
106. Pharmaceutical composition characterized by the fact that it comprises the virus vector as defined in any one of claims 101 to 105.
[107]
107. Pharmaceutical composition according to claim 106, characterized in that the composition further comprises a pharmaceutically acceptable carrier.
[108]
108. Method of introducing a nucleic acid molecule into a cell, characterized in that it comprises contacting the cell with the AVV virus vector as defined in any one of claims 101 to 105.
[109]
109. Method of introducing a nucleic acid molecule into a cell, characterized by the fact that it comprises
Petition 870190078272, of 8/13/2019, p. 311/335
17/19 to contact the cell with the pharmaceutical composition as defined in claim 106 or 107.
[110]
110. Method according to claim 108 or 109, characterized in that the virus vector or composition is administered to a subject's central nervous system.
[111]
111. Method according to claim 110, characterized by the fact that the virus vector or composition is released through the blood-brain barrier.
[112]
112. Method according to claim 108 or 109, characterized in that the virus vector or composition is detargeted from the liver.
[113]
113. The method of claim 108 or 109, characterized in that the virus vector or composition is detached from the kidney.
[114]
114. Method according to claim 108 or 109, characterized in that the virus vector or composition is detargeted from the spleen.
[115]
115. Method of selectively delivering a therapeutic protein or therapeutic RNA to a neuronal cell in a subject, characterized in that it comprises contacting the neuronal cell with the virus vector as defined in any of claims 101 to 105 or the composition as defined in claims 106 to 107, wherein the virus vector or composition comprises the therapeutic protein or therapeutic RNA.
[116]
116. Method according to claim 115, characterized by the fact that the virus vector or composition is detargeted from the liver.
[117]
117. Method according to claim 115, characterized by the fact that the virus vector or composition is detargeted from the kidney.
Petition 870190078272, of 8/13/2019, p. 312/335
18/19
[118]
118. The method of claim 115, characterized by the fact that the virus vector or composition is detargeted from the spleen.
[119]
119. Method of treating a neurological disorder or defect in a subject, characterized in that the method comprises administering to the subject the virus vector as defined in any one of claims 101 to 105 or the composition as defined in claims 106 to 107 , wherein the virus vector or composition comprises a nucleic acid molecule encoding a therapeutic protein or therapeutic RNA effective in the treatment of neurological disorder.
[120]
120. Method according to claim 119, characterized in that it further comprises the treatment of a cardiovascular disorder or defect in the subject.
[121]
121. Method according to claim 119, characterized in that the virus vector or composition is selectively released to a neuronal cell.
[122]
122. The method of claim 119, characterized in that the virus vector or composition is selectively released to a cardiomyocyte.
[123]
123. The method of claim 119, characterized in that the virus vector or composition is detargeted from the liver, kidney and / or spleen.
[124]
124. Method according to any one of claims 108 to 123, characterized in that the subject is a mammal.
[125]
125. Method according to any of claims 108 to 124, characterized by the fact that the subject is a human being.
[126]
126. Method according to any of the claims
Petition 870190078272, of 8/13/2019, p. 313/335
19/19 tions 108 to 125, characterized by the fact that the virus vector or composition is released to the subject through the administration route selected from the group consisting of intravenous, intraarterial, intraperitoneal, intracerebroventrical, intracisternal, intraparenchymal, intracranial , and intrathecal.
[127]
127. Method according to claim 126, characterized in that the virus vector or composition is released to the subject through intravenous administration.

类似技术:

---

公开号 | 公开日 | 专利标题

---

BR112019016769A2|2020-05-26|METHODS AND COMPOSITIONS FOR GENETIC TRANSFER THROUGH VASCULATURE

---

ES2865487T3|2021-10-15|Methods and compositions for viral vectors that evade antibodies

---

JP6042825B2|2016-12-14|Viral vectors with modified transduction profiles and methods for their production and use

---

US10907176B2|2021-02-02|Methods and compositions for targeted gene transfer

---

JP2019506445A|2019-03-07|Modified capsid protein for enhanced delivery of parvovirus vectors

---

AU2005316476A1|2006-06-22|Chimeric vectors

---

JP2021502086A|2021-01-28|Methods and compositions for circular RNA molecules

---

BR112020020341A2|2021-01-05|VIRUS VECTORS TARGETED TO OPHTHALMIC TISSUES

---

JP2021507710A|2021-02-25|Methods and compositions for delivering viral vectors across the blood-brain barrier

---

KR20210006357A|2021-01-18|Antibody-avoiding virus vector

---

CN113727992A|2021-11-30|Recombinant adeno-associated virus vector

---

CN110691846A|2020-01-14|Rational polyploid adeno-associated virus vectors and methods of making and using same

同族专利:

---

公开号 | 公开日

---

CN110520536A|2019-11-29|

---

EP3583220A1|2019-12-25|

---

EA201991911A1|2020-02-20|

---

WO2018152333A1|2018-08-23|

---

CA3052829A1|2018-08-23|

---

IL268534D0|2019-09-26|

---

MX2019009720A|2019-10-07|

---

JP2020505936A|2020-02-27|

---

US20190367562A1|2019-12-05|

---

AU2018221738A1|2019-08-22|

---

EP3583220A4|2021-07-07|

---

EA038695B1|2021-10-06|

---

WO2018152333A9|2019-01-24|

---

SG11201907298WA|2019-09-27|

---

KR20190117571A|2019-10-16|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

WO2000028004A1|1998-11-10|2000-05-18|The University Of North Carolina At Chapel Hill|Virus vectors and methods of making and administering the same|

---

DE19933288A1|1999-07-15|2001-01-18|Medigene Ag|Structural protein of adeno-associated virus with altered antigenicity, its production and use|

---

DE60323078D1|2002-05-01|2008-10-02|Univ Florida|IMPROVED RAAV EXPRESSION SYSTEMS FOR THE GENETIC MODIFICATION OF SPECIFIC CAPSID PROTEINS|

---

EP3151866A4|2014-06-09|2017-11-22|Voyager Therapeutics, Inc.|Chimeric capsids|

---

US20180216133A1|2015-07-17|2018-08-02|The Trustees Of The University Of Pennsylvania|Compositions and methods for achieving high levels of transduction in human liver cells|GB201508026D0|2015-05-11|2015-06-24|Ucl Business Plc|Capsid|

---

AU2016332821B2|2015-09-28|2022-02-17|The University Of North Carolina At Chapel Hill|Methods and compositions for antibody-evading virus vectors|

---

EP3856913A1|2018-09-26|2021-08-04|California Institute Of Technology|Adeno-associated virus compositions for targeted gene therapy|

---

TW202102526A|2019-04-04|2021-01-16|美商銳進科斯生物股份有限公司|Recombinant adeno-associated viruses and uses thereof|

---

WO2021030764A1|2019-08-14|2021-02-18|University Of Florida Research Foundation, Incorporated|Aav capsid variants for gene therapy|

---

WO2021050614A2|2019-09-09|2021-03-18|Massachusetts Eye And Ear Infirmary|Methods and compositions for modulating the interaction between adeno-associated virusand the aav receptorfor altered bio-distribution of aav|

---

WO2021102234A1|2019-11-22|2021-05-27|The Children's Hospital Of Philadelphia|Adeno-associated viral vector variants|

---

WO2021142300A2|2020-01-10|2021-07-15|The Brigham And Women's Hospital, Inc.|Methods and compositions for delivery of immunotherapy agents across the blood-brain barrier to treat brain cancer|

---

WO2021163357A2|2020-02-13|2021-08-19|Tenaya Therapeutics, Inc.|Gene therapy vectors for treating heart disease|

---

WO2021168509A1|2020-02-25|2021-09-02|Children's Medical Research Institute|Adeno-associated virus capsid polypeptides and vectors|

---

CN113480615A|2021-07-30|2021-10-08|上海信致医药科技有限公司|Novel adeno-associated virus capsid protein with high retinal affinity and application thereof|

---

CN113563430A|2021-07-30|2021-10-29|上海信致医药科技有限公司|Gene delivery system for treating ocular diseases and uses thereof|

法律状态:
2021-10-19| B350| Update of information on the portal [chapter 15.35 patent gazette]|

优先权:

---

申请号 | 申请日 | 专利标题

---

US201762459286P| true| 2017-02-15|2017-02-15|

---

US62/459,286|2017-02-15|

---

PCT/US2018/018381|WO2018152333A1|2017-02-15|2018-02-15|Methods and compositions for gene transfer across the vasculature|

---